Mutagenetix > Incidental Mutation

Incidental Mutation 'R1310:Def6'

157913

Institutional Source

Beutler Lab

Gene Symbol

Def6

Ensembl Gene

ENSMUSG00000002257

Gene Name

differentially expressed in FDCP 6

Synonyms

IBP, SLAT, 6430538D02Rik, IRF-4-binding protein, 2410003F05Rik

MMRRC Submission

039376-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1310 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

28207778-28228608 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 28217619 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 86 (V86I)

Ref Sequence

ENSEMBL: ENSMUSP00000002327 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002327]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000002327
AA Change: V86I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000002327
Gene: ENSMUSG00000002257
AA Change: V86I

Domain	Start	End	E-Value	Type
low complexity region	145	166	N/A	INTRINSIC
PH	217	314	3.87e-20	SMART
coiled coil region	318	551	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEF6, or IBP, is a guanine nucleotide exchange factor (GEF) for RAC (MIM 602048) and CDC42 (MIM 116952) that is highly expressed in B and T cells (Gupta et al., 2003 [PubMed 12923183]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutants spontaneously develop systemic autoimmunity. Females primarily are affected, displaying hypergammaglobulinemia, accumulation of effector/memory T cells and IgG+ B cells, and production of autoantibodies [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 22 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgre1	A	G	17: 57,447,936	H678R	probably benign	Het
Adgrv1	A	G	13: 81,566,377	V929A	probably benign	Het
Bcl10	T	G	3: 145,930,425	V26G	probably damaging	Het
C4b	A	G	17: 34,729,593	V1581A	probably damaging	Het
C87436	A	G	6: 86,445,450	E2G	possibly damaging	Het
Drd3	A	G	16: 43,821,529	K403E	probably damaging	Het
Eme1	G	A	11: 94,645,542	R534C	probably damaging	Het
H2-T24	G	T	17: 36,014,996	Y234*	probably null	Het
Hoxa13	CCG	CCGCG	6: 52,260,635		probably null	Het
Ifit1bl1	A	G	19: 34,593,696	S454P	possibly damaging	Het
Olfr1265	T	A	2: 90,037,703	D261E	probably benign	Het
Olfr644	C	T	7: 104,068,598	M144I	probably benign	Het
Pde4c	A	G	8: 70,749,923	D592G	possibly damaging	Het
Scn11a	C	T	9: 119,755,057	W1497*	probably null	Het
Sik3	A	G	9: 46,219,426	E1170G	possibly damaging	Het
Soat1	A	G	1: 156,441,332	L183P	possibly damaging	Het
Svep1	T	A	4: 58,069,416	Y2790F	possibly damaging	Het
Tmeff2	T	C	1: 51,181,787	V307A	probably damaging	Het
Tmem38a	T	A	8: 72,579,970	F98I	probably damaging	Het
Yod1	C	T	1: 130,718,830	A148V	probably benign	Het
Zfp850	A	C	7: 27,989,459	S441R	probably benign	Het
Zfp976	G	A	7: 42,613,186	P409L	probably damaging	Het

Other mutations in Def6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01603:Def6	APN	17	28219740	splice site	probably benign
IGL01619:Def6	APN	17	28207864	missense	probably damaging	1.00
IGL01737:Def6	APN	17	28223727	missense	possibly damaging	0.94
IGL02550:Def6	APN	17	28228261	missense	probably benign	0.03
Huntsville	UTSW	17	28219976	missense	probably damaging	0.99
Redstone	UTSW	17	28217755	missense	probably damaging	1.00
Silos	UTSW	17	28217092	missense	probably damaging	1.00
R0013:Def6	UTSW	17	28217092	missense	probably damaging	1.00
R0335:Def6	UTSW	17	28228069	missense	possibly damaging	0.83
R0357:Def6	UTSW	17	28223935	missense	probably damaging	1.00
R0373:Def6	UTSW	17	28220180	missense	probably damaging	0.96
R1161:Def6	UTSW	17	28217619	missense	probably benign	0.00
R1470:Def6	UTSW	17	28225982	missense	possibly damaging	0.67
R1470:Def6	UTSW	17	28225982	missense	possibly damaging	0.67
R1636:Def6	UTSW	17	28223918	missense	possibly damaging	0.95
R1778:Def6	UTSW	17	28220186	missense	probably benign	0.02
R2432:Def6	UTSW	17	28228069	missense	probably benign	0.03
R3881:Def6	UTSW	17	28220215	missense	probably damaging	1.00
R4402:Def6	UTSW	17	28219976	missense	probably damaging	0.99
R4589:Def6	UTSW	17	28228147	missense	probably benign
R4683:Def6	UTSW	17	28217635	missense	probably damaging	0.99
R5704:Def6	UTSW	17	28228226	missense	probably benign
R6481:Def6	UTSW	17	28226163	missense	probably benign	0.00
R6805:Def6	UTSW	17	28223717	missense	probably damaging	1.00
R7029:Def6	UTSW	17	28225969	missense	probably benign	0.05
R7863:Def6	UTSW	17	28227867	missense	possibly damaging	0.62
R8229:Def6	UTSW	17	28217755	missense	probably damaging	1.00
R8856:Def6	UTSW	17	28216998	missense	probably damaging	1.00
R9297:Def6	UTSW	17	28217740	missense	probably damaging	1.00
R9671:Def6	UTSW	17	28219781	missense	probably benign	0.04
R9684:Def6	UTSW	17	28217070	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTTTCTCCCTTGGGCTGAGAAAC -3'
(R):5'- TGTCACCCTTACCTCATCGGGAAC -3'

Sequencing Primer
(F):5'- ATTGGAGTGTCTGAGCCAAC -3'
(R):5'- TCATCGGGAACCATGATCAG -3'

Posted On

2014-02-18