Incidental Mutation 'R1311:Htr2b'
ID157919
Institutional Source Beutler Lab
Gene Symbol Htr2b
Ensembl Gene ENSMUSG00000026228
Gene Name5-hydroxytryptamine (serotonin) receptor 2B
Synonyms5-HT2B
MMRRC Submission 039377-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.485) question?
Stock #R1311 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location86099026-86111970 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 86110624 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 87 (A87S)
Ref Sequence ENSEMBL: ENSMUSP00000027431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027431] [ENSMUST00000027432] [ENSMUST00000139715] [ENSMUST00000155077]
Predicted Effect probably damaging
Transcript: ENSMUST00000027431
AA Change: A87S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027431
Gene: ENSMUSG00000026228
AA Change: A87S

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 63 394 5.9e-12 PFAM
Pfam:7tm_1 70 379 4.5e-65 PFAM
low complexity region 447 465 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000027432
SMART Domains Protein: ENSMUSP00000027432
Gene: ENSMUSG00000026229

DomainStartEndE-ValueType
Pfam:PC_rep 441 474 5.1e-9 PFAM
Pfam:PC_rep 476 510 8.4e-8 PFAM
Pfam:PC_rep 511 545 1.1e-7 PFAM
Pfam:HEAT_2 599 693 3.3e-15 PFAM
Pfam:PC_rep 651 685 1.1e-11 PFAM
low complexity region 818 828 N/A INTRINSIC
low complexity region 837 872 N/A INTRINSIC
low complexity region 936 949 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139715
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152184
Predicted Effect probably damaging
Transcript: ENSMUST00000155077
AA Change: A17S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116273
Gene: ENSMUSG00000026228
AA Change: A17S

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 1 125 8.2e-8 PFAM
Pfam:7TM_GPCR_Srx 1 128 1.1e-6 PFAM
Pfam:7tm_1 1 172 6e-40 PFAM
Meta Mutation Damage Score 0.3745 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.1%
  • 20x: 86.2%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the several different receptors for 5-hydroxytryptamine (serotonin) that belongs to the G-protein coupled receptor 1 family. Serotonin is a biogenic hormone that functions as a neurotransmitter, a hormone, and a mitogen. Serotonin receptors mediate many of the central and peripheral physiologic functions of serotonin, including regulation of cardiovascular functions and impulsive behavior. Population and family-based analyses of a minor allele (glutamine-to-stop substitution, designated Q20*) which blocks expression of this protein, and knockout studies in mice, suggest a role for this gene in impulsivity. However, other factors, such as elevated testosterone levels, may also be involved. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2016]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit a lack of cardiac trabeculae, ventricular hypoplasia due to impaired myocyte proliferation, and midgestational and neonatal lethality of variable severity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1c T C 2: 58,280,249 Q449R probably benign Het
Cap1 A G 4: 122,865,214 Y195H possibly damaging Het
Casp8ap2 T A 4: 32,648,111 N1939K probably damaging Het
Cd209c T A 8: 3,945,908 M1L probably benign Het
Ckb TCCACCACCA TCCACCA 12: 111,669,645 probably benign Het
Col13a1 A G 10: 61,864,010 probably benign Het
Dennd4a T C 9: 64,910,004 V1640A probably benign Het
Eml6 T C 11: 29,831,088 probably benign Het
Fat3 G A 9: 16,021,410 T1409I probably damaging Het
Gm4884 G C 7: 41,043,115 E169D possibly damaging Het
Gm5709 T C 3: 59,618,679 noncoding transcript Het
Kansl2 G T 15: 98,528,916 H275N possibly damaging Het
Megf6 G A 4: 154,263,782 probably null Het
Mtpn A G 6: 35,512,250 I113T possibly damaging Het
Myh6 G T 14: 54,946,365 A1704E probably damaging Het
Notum C T 11: 120,655,749 probably benign Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfml1 T C 7: 107,567,896 probably null Het
Olfr295 T A 7: 86,585,953 V226D probably damaging Het
Ptpn5 A T 7: 47,079,232 probably benign Het
Rapgef2 A G 3: 79,083,547 F985L probably benign Het
Slc7a7 A T 14: 54,373,030 Y386* probably null Het
Snph G T 2: 151,597,202 P36Q probably damaging Het
St18 T C 1: 6,845,644 C838R probably damaging Het
Sucla2 C T 14: 73,560,634 probably benign Het
Supt7l T C 5: 31,520,261 Y187C probably damaging Het
Sycp2l A T 13: 41,135,185 K241* probably null Het
Tenm2 G T 11: 36,068,594 probably benign Het
Tfap4 A G 16: 4,559,426 probably null Het
Tmem132e T C 11: 82,444,296 Y643H probably damaging Het
Tmem200c A T 17: 68,840,763 S114C probably damaging Het
Ush2a T C 1: 188,947,145 I4850T possibly damaging Het
Zmym6 G T 4: 127,123,358 L977F probably damaging Het
Other mutations in Htr2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02434:Htr2b APN 1 86110770 missense probably benign
IGL03239:Htr2b APN 1 86099692 missense probably damaging 1.00
IGL03303:Htr2b APN 1 86099339 unclassified probably benign
P0035:Htr2b UTSW 1 86110730 missense probably benign
R0655:Htr2b UTSW 1 86110843 missense probably benign
R0748:Htr2b UTSW 1 86110806 missense probably benign 0.00
R1848:Htr2b UTSW 1 86099429 missense possibly damaging 0.90
R1916:Htr2b UTSW 1 86099801 missense probably damaging 1.00
R2938:Htr2b UTSW 1 86102455 missense possibly damaging 0.74
R4959:Htr2b UTSW 1 86100091 missense probably damaging 1.00
R6501:Htr2b UTSW 1 86110641 missense probably damaging 1.00
R6508:Htr2b UTSW 1 86102464 missense possibly damaging 0.94
R6841:Htr2b UTSW 1 86099893 missense probably benign 0.45
R8247:Htr2b UTSW 1 86100095 missense probably benign
R8275:Htr2b UTSW 1 86102572 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGAGGAAGGGTAAACATGCTCC -3'
(R):5'- CACCAAAAGGCGAATGGCTTCATC -3'

Sequencing Primer
(F):5'- TGTCCTTTCACAGTAACTACAAATC -3'
(R):5'- GATCCTGACTAACCGTTCTGG -3'
Posted On2014-02-18