Incidental Mutation 'R1311:Casp8ap2'
ID 157925
Institutional Source Beutler Lab
Gene Symbol Casp8ap2
Ensembl Gene ENSMUSG00000028282
Gene Name caspase 8 associated protein 2
Synonyms FLASH, D4Ertd659e
MMRRC Submission 039377-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1311 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 32615451-32653265 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 32648111 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 1939 (N1939K)
Ref Sequence ENSEMBL: ENSMUSP00000136016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029950] [ENSMUST00000108178] [ENSMUST00000178925]
AlphaFold Q9WUF3
Predicted Effect probably damaging
Transcript: ENSMUST00000029950
AA Change: N1939K

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029950
Gene: ENSMUSG00000028282
AA Change: N1939K

DomainStartEndE-ValueType
coiled coil region 68 142 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 458 477 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1250 1268 N/A INTRINSIC
low complexity region 1360 1377 N/A INTRINSIC
low complexity region 1458 1470 N/A INTRINSIC
low complexity region 1477 1498 N/A INTRINSIC
low complexity region 1882 1895 N/A INTRINSIC
PDB:2LR8|A 1896 1962 1e-31 PDB
Blast:SANT 1905 1955 2e-21 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000108178
AA Change: N167K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000103813
Gene: ENSMUSG00000028282
AA Change: N167K

DomainStartEndE-ValueType
PDB:2LR8|A 126 190 4e-26 PDB
Blast:SANT 139 183 4e-19 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000178925
AA Change: N1939K

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000136016
Gene: ENSMUSG00000028282
AA Change: N1939K

DomainStartEndE-ValueType
coiled coil region 68 142 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 458 477 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1250 1268 N/A INTRINSIC
low complexity region 1360 1377 N/A INTRINSIC
low complexity region 1458 1470 N/A INTRINSIC
low complexity region 1477 1498 N/A INTRINSIC
low complexity region 1882 1895 N/A INTRINSIC
PDB:2LR8|A 1896 1962 1e-31 PDB
Blast:SANT 1905 1955 2e-21 BLAST
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.1%
  • 20x: 86.2%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein is highly similar to FLASH, a mouse apoptotic protein identified by its interaction with the death-effector domain (DED) of caspase 8. Studies of FLASH protein suggested that this protein may be a component of the death-inducing signaling complex that includes Fas receptor, Fas-binding adapter FADD, and caspase 8, and plays a regulatory role in Fas-mediated apoptosis. Alternative splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for disruption of this gene die before implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1c T C 2: 58,280,249 Q449R probably benign Het
Cap1 A G 4: 122,865,214 Y195H possibly damaging Het
Cd209c T A 8: 3,945,908 M1L probably benign Het
Ckb TCCACCACCA TCCACCA 12: 111,669,645 probably benign Het
Col13a1 A G 10: 61,864,010 probably benign Het
Dennd4a T C 9: 64,910,004 V1640A probably benign Het
Eml6 T C 11: 29,831,088 probably benign Het
Fat3 G A 9: 16,021,410 T1409I probably damaging Het
Gm4884 G C 7: 41,043,115 E169D possibly damaging Het
Gm5709 T C 3: 59,618,679 noncoding transcript Het
Htr2b C A 1: 86,110,624 A87S probably damaging Het
Kansl2 G T 15: 98,528,916 H275N possibly damaging Het
Megf6 G A 4: 154,263,782 probably null Het
Mtpn A G 6: 35,512,250 I113T possibly damaging Het
Myh6 G T 14: 54,946,365 A1704E probably damaging Het
Notum C T 11: 120,655,749 probably benign Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfml1 T C 7: 107,567,896 probably null Het
Olfr295 T A 7: 86,585,953 V226D probably damaging Het
Ptpn5 A T 7: 47,079,232 probably benign Het
Rapgef2 A G 3: 79,083,547 F985L probably benign Het
Slc7a7 A T 14: 54,373,030 Y386* probably null Het
Snph G T 2: 151,597,202 P36Q probably damaging Het
St18 T C 1: 6,845,644 C838R probably damaging Het
Sucla2 C T 14: 73,560,634 probably benign Het
Supt7l T C 5: 31,520,261 Y187C probably damaging Het
Sycp2l A T 13: 41,135,185 K241* probably null Het
Tenm2 G T 11: 36,068,594 probably benign Het
Tfap4 A G 16: 4,559,426 probably null Het
Tmem132e T C 11: 82,444,296 Y643H probably damaging Het
Tmem200c A T 17: 68,840,763 S114C probably damaging Het
Ush2a T C 1: 188,947,145 I4850T possibly damaging Het
Zmym6 G T 4: 127,123,358 L977F probably damaging Het
Other mutations in Casp8ap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00686:Casp8ap2 APN 4 32641433 missense probably damaging 1.00
IGL00714:Casp8ap2 APN 4 32649192 missense probably damaging 1.00
IGL00754:Casp8ap2 APN 4 32641036 missense probably benign 0.00
IGL00954:Casp8ap2 APN 4 32645403 missense probably damaging 1.00
IGL00970:Casp8ap2 APN 4 32646182 missense probably benign
IGL01534:Casp8ap2 APN 4 32648134 splice site probably benign
IGL01596:Casp8ap2 APN 4 32646365 missense probably damaging 1.00
IGL01686:Casp8ap2 APN 4 32641294 missense possibly damaging 0.94
IGL02002:Casp8ap2 APN 4 32639391 missense probably damaging 1.00
IGL02273:Casp8ap2 APN 4 32643974 missense probably damaging 1.00
IGL02510:Casp8ap2 APN 4 32639704 missense probably benign 0.05
IGL02600:Casp8ap2 APN 4 32630246 missense probably null 1.00
IGL02929:Casp8ap2 APN 4 32624105 utr 5 prime probably benign
F5770:Casp8ap2 UTSW 4 32639944 missense probably benign 0.00
IGL02988:Casp8ap2 UTSW 4 32644590 missense probably benign 0.14
R0023:Casp8ap2 UTSW 4 32640185 missense probably damaging 0.99
R0027:Casp8ap2 UTSW 4 32643810 missense probably benign 0.01
R0090:Casp8ap2 UTSW 4 32640327 missense probably damaging 1.00
R0117:Casp8ap2 UTSW 4 32640817 missense probably benign 0.00
R0144:Casp8ap2 UTSW 4 32643797 missense possibly damaging 0.50
R0268:Casp8ap2 UTSW 4 32644079 missense probably damaging 0.99
R0344:Casp8ap2 UTSW 4 32644079 missense probably damaging 0.99
R0555:Casp8ap2 UTSW 4 32640381 missense probably damaging 1.00
R1051:Casp8ap2 UTSW 4 32640790 missense probably benign 0.28
R1165:Casp8ap2 UTSW 4 32640563 missense probably benign 0.01
R1243:Casp8ap2 UTSW 4 32645687 missense probably benign 0.03
R1337:Casp8ap2 UTSW 4 32645721 missense possibly damaging 0.64
R1471:Casp8ap2 UTSW 4 32639386 nonsense probably null
R1497:Casp8ap2 UTSW 4 32639938 missense probably benign 0.00
R1521:Casp8ap2 UTSW 4 32631867 missense probably damaging 1.00
R1588:Casp8ap2 UTSW 4 32640541 missense probably benign 0.00
R1625:Casp8ap2 UTSW 4 32648068 missense probably benign 0.04
R1731:Casp8ap2 UTSW 4 32641442 missense possibly damaging 0.94
R1899:Casp8ap2 UTSW 4 32643647 missense probably damaging 0.98
R2000:Casp8ap2 UTSW 4 32634874 missense probably damaging 1.00
R2021:Casp8ap2 UTSW 4 32644560 missense probably benign 0.05
R2022:Casp8ap2 UTSW 4 32644560 missense probably benign 0.05
R2023:Casp8ap2 UTSW 4 32644560 missense probably benign 0.05
R2088:Casp8ap2 UTSW 4 32631126 missense probably damaging 1.00
R2104:Casp8ap2 UTSW 4 32644727 missense probably benign 0.00
R2128:Casp8ap2 UTSW 4 32640142 missense probably benign 0.06
R2129:Casp8ap2 UTSW 4 32640142 missense probably benign 0.06
R2305:Casp8ap2 UTSW 4 32646411 missense probably damaging 1.00
R2316:Casp8ap2 UTSW 4 32643781 missense probably benign 0.31
R2919:Casp8ap2 UTSW 4 32645343 missense probably damaging 1.00
R4091:Casp8ap2 UTSW 4 32643611 missense probably damaging 1.00
R4357:Casp8ap2 UTSW 4 32646150 missense probably benign 0.00
R4807:Casp8ap2 UTSW 4 32644505 missense possibly damaging 0.89
R4828:Casp8ap2 UTSW 4 32639807 missense probably benign
R4908:Casp8ap2 UTSW 4 32639905 missense possibly damaging 0.90
R4945:Casp8ap2 UTSW 4 32631163 missense possibly damaging 0.57
R4962:Casp8ap2 UTSW 4 32640554 missense probably damaging 0.99
R6014:Casp8ap2 UTSW 4 32641400 missense probably damaging 0.97
R6092:Casp8ap2 UTSW 4 32639380 missense probably damaging 1.00
R6257:Casp8ap2 UTSW 4 32641364 missense possibly damaging 0.94
R6289:Casp8ap2 UTSW 4 32639590 missense probably damaging 1.00
R6482:Casp8ap2 UTSW 4 32634813 missense probably damaging 1.00
R6496:Casp8ap2 UTSW 4 32641553 missense probably benign 0.05
R6515:Casp8ap2 UTSW 4 32646423 missense possibly damaging 0.64
R7015:Casp8ap2 UTSW 4 32644278 missense probably damaging 1.00
R7033:Casp8ap2 UTSW 4 32639392 missense probably damaging 1.00
R7072:Casp8ap2 UTSW 4 32644766 missense probably damaging 1.00
R7448:Casp8ap2 UTSW 4 32643974 missense possibly damaging 0.84
R7944:Casp8ap2 UTSW 4 32645909 missense probably benign 0.12
R7945:Casp8ap2 UTSW 4 32645909 missense probably benign 0.12
R8170:Casp8ap2 UTSW 4 32615490 splice site probably benign
R8179:Casp8ap2 UTSW 4 32643939 nonsense probably null
R8207:Casp8ap2 UTSW 4 32646446 missense possibly damaging 0.63
R8263:Casp8ap2 UTSW 4 32644072 missense probably damaging 1.00
R8298:Casp8ap2 UTSW 4 32640429 missense probably benign 0.30
R9441:Casp8ap2 UTSW 4 32645873 missense probably benign 0.00
R9455:Casp8ap2 UTSW 4 32643924 missense possibly damaging 0.85
R9729:Casp8ap2 UTSW 4 32643807 missense possibly damaging 0.71
V7580:Casp8ap2 UTSW 4 32639944 missense probably benign 0.00
X0018:Casp8ap2 UTSW 4 32643738 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTCCCTGTCACAGTCACCGAGA -3'
(R):5'- TGTGGGGATAAGGACATAACTGATGCT -3'

Sequencing Primer
(F):5'- GACCTAGCTTGTTTCTTGACTAGAAC -3'
(R):5'- GTATATCTTTAAACCCAGCACTCAG -3'
Posted On 2014-02-18