Incidental Mutation 'R1311:Olfml1'
ID157933
Institutional Source Beutler Lab
Gene Symbol Olfml1
Ensembl Gene ENSMUSG00000051041
Gene Nameolfactomedin-like 1
SynonymsONT2, mONT2, MVAL564
MMRRC Submission 039377-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R1311 (G1)
Quality Score172
Status Validated
Chromosome7
Chromosomal Location107567446-107591094 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 107567896 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120990]
Predicted Effect probably null
Transcript: ENSMUST00000120990
SMART Domains Protein: ENSMUSP00000114029
Gene: ENSMUSG00000051041

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
coiled coil region 78 105 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
Pfam:OLF 145 233 5.5e-19 PFAM
Meta Mutation Damage Score 0.9492 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.1%
  • 20x: 86.2%
Validation Efficiency 98% (42/43)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1c T C 2: 58,280,249 Q449R probably benign Het
Cap1 A G 4: 122,865,214 Y195H possibly damaging Het
Casp8ap2 T A 4: 32,648,111 N1939K probably damaging Het
Cd209c T A 8: 3,945,908 M1L probably benign Het
Ckb TCCACCACCA TCCACCA 12: 111,669,645 probably benign Het
Col13a1 A G 10: 61,864,010 probably benign Het
Dennd4a T C 9: 64,910,004 V1640A probably benign Het
Eml6 T C 11: 29,831,088 probably benign Het
Fat3 G A 9: 16,021,410 T1409I probably damaging Het
Gm4884 G C 7: 41,043,115 E169D possibly damaging Het
Gm5709 T C 3: 59,618,679 noncoding transcript Het
Htr2b C A 1: 86,110,624 A87S probably damaging Het
Kansl2 G T 15: 98,528,916 H275N possibly damaging Het
Megf6 G A 4: 154,263,782 probably null Het
Mtpn A G 6: 35,512,250 I113T possibly damaging Het
Myh6 G T 14: 54,946,365 A1704E probably damaging Het
Notum C T 11: 120,655,749 probably benign Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr295 T A 7: 86,585,953 V226D probably damaging Het
Ptpn5 A T 7: 47,079,232 probably benign Het
Rapgef2 A G 3: 79,083,547 F985L probably benign Het
Slc7a7 A T 14: 54,373,030 Y386* probably null Het
Snph G T 2: 151,597,202 P36Q probably damaging Het
St18 T C 1: 6,845,644 C838R probably damaging Het
Sucla2 C T 14: 73,560,634 probably benign Het
Supt7l T C 5: 31,520,261 Y187C probably damaging Het
Sycp2l A T 13: 41,135,185 K241* probably null Het
Tenm2 G T 11: 36,068,594 probably benign Het
Tfap4 A G 16: 4,559,426 probably null Het
Tmem132e T C 11: 82,444,296 Y643H probably damaging Het
Tmem200c A T 17: 68,840,763 S114C probably damaging Het
Ush2a T C 1: 188,947,145 I4850T possibly damaging Het
Zmym6 G T 4: 127,123,358 L977F probably damaging Het
Other mutations in Olfml1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01285:Olfml1 APN 7 107590157 missense possibly damaging 0.80
IGL02355:Olfml1 APN 7 107567803 missense probably benign 0.00
IGL02362:Olfml1 APN 7 107567803 missense probably benign 0.00
IGL03218:Olfml1 APN 7 107571269 missense possibly damaging 0.87
IGL03291:Olfml1 APN 7 107590229 missense probably damaging 1.00
R0041:Olfml1 UTSW 7 107590186 missense possibly damaging 0.81
R0041:Olfml1 UTSW 7 107590186 missense possibly damaging 0.81
R0081:Olfml1 UTSW 7 107571299 missense probably benign 0.08
R0524:Olfml1 UTSW 7 107590177 missense probably damaging 1.00
R1548:Olfml1 UTSW 7 107590375 missense possibly damaging 0.88
R1564:Olfml1 UTSW 7 107571139 missense possibly damaging 0.89
R4347:Olfml1 UTSW 7 107567833 missense probably benign 0.00
R4997:Olfml1 UTSW 7 107571206 missense probably damaging 1.00
R6788:Olfml1 UTSW 7 107567868 missense probably damaging 1.00
R7282:Olfml1 UTSW 7 107590323 missense possibly damaging 0.85
R7703:Olfml1 UTSW 7 107571185 missense probably damaging 1.00
R7922:Olfml1 UTSW 7 107571149 missense probably damaging 1.00
R8324:Olfml1 UTSW 7 107590363 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TCTGGCTATGCAAAGCGTTGTTTTC -3'
(R):5'- CATCTGAGCTGCTAGGCTATGCAC -3'

Sequencing Primer
(F):5'- GTTTTCCAAGGAATTGCCACAG -3'
(R):5'- TGCTAGGCTATGCACATCTG -3'
Posted On2014-02-18