Incidental Mutation 'R1311:Kansl2'
ID157948
Institutional Source Beutler Lab
Gene Symbol Kansl2
Ensembl Gene ENSMUSG00000022992
Gene NameKAT8 regulatory NSL complex subunit 2
Synonyms2310037I24Rik
MMRRC Submission 039377-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock #R1311 (G1)
Quality Score140
Status Validated
Chromosome15
Chromosomal Location98517658-98534264 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 98528916 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 275 (H275N)
Ref Sequence ENSEMBL: ENSMUSP00000155089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023727] [ENSMUST00000116400] [ENSMUST00000230542] [ENSMUST00000231066]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023727
AA Change: H275N

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000023727
Gene: ENSMUSG00000022992
AA Change: H275N

DomainStartEndE-ValueType
Pfam:zf-C3Hc3H 27 93 4.8e-19 PFAM
Pfam:zf-C3Hc3H 300 365 4.6e-19 PFAM
low complexity region 408 420 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000084005
Predicted Effect possibly damaging
Transcript: ENSMUST00000116400
AA Change: H275N

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112101
Gene: ENSMUSG00000022992
AA Change: H275N

DomainStartEndE-ValueType
Pfam:zf-C3Hc3H 28 92 1e-19 PFAM
Pfam:zf-C3Hc3H 302 364 1.7e-16 PFAM
low complexity region 442 454 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229818
Predicted Effect possibly damaging
Transcript: ENSMUST00000230542
AA Change: H275N

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000231066
Meta Mutation Damage Score 0.2140 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.1%
  • 20x: 86.2%
Validation Efficiency 98% (42/43)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1c T C 2: 58,280,249 Q449R probably benign Het
Cap1 A G 4: 122,865,214 Y195H possibly damaging Het
Casp8ap2 T A 4: 32,648,111 N1939K probably damaging Het
Cd209c T A 8: 3,945,908 M1L probably benign Het
Ckb TCCACCACCA TCCACCA 12: 111,669,645 probably benign Het
Col13a1 A G 10: 61,864,010 probably benign Het
Dennd4a T C 9: 64,910,004 V1640A probably benign Het
Eml6 T C 11: 29,831,088 probably benign Het
Fat3 G A 9: 16,021,410 T1409I probably damaging Het
Gm4884 G C 7: 41,043,115 E169D possibly damaging Het
Gm5709 T C 3: 59,618,679 noncoding transcript Het
Htr2b C A 1: 86,110,624 A87S probably damaging Het
Megf6 G A 4: 154,263,782 probably null Het
Mtpn A G 6: 35,512,250 I113T possibly damaging Het
Myh6 G T 14: 54,946,365 A1704E probably damaging Het
Notum C T 11: 120,655,749 probably benign Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfml1 T C 7: 107,567,896 probably null Het
Olfr295 T A 7: 86,585,953 V226D probably damaging Het
Ptpn5 A T 7: 47,079,232 probably benign Het
Rapgef2 A G 3: 79,083,547 F985L probably benign Het
Slc7a7 A T 14: 54,373,030 Y386* probably null Het
Snph G T 2: 151,597,202 P36Q probably damaging Het
St18 T C 1: 6,845,644 C838R probably damaging Het
Sucla2 C T 14: 73,560,634 probably benign Het
Supt7l T C 5: 31,520,261 Y187C probably damaging Het
Sycp2l A T 13: 41,135,185 K241* probably null Het
Tenm2 G T 11: 36,068,594 probably benign Het
Tfap4 A G 16: 4,559,426 probably null Het
Tmem132e T C 11: 82,444,296 Y643H probably damaging Het
Tmem200c A T 17: 68,840,763 S114C probably damaging Het
Ush2a T C 1: 188,947,145 I4850T possibly damaging Het
Zmym6 G T 4: 127,123,358 L977F probably damaging Het
Other mutations in Kansl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00822:Kansl2 APN 15 98528853 splice site probably benign
IGL02167:Kansl2 APN 15 98533515 splice site probably benign
IGL02349:Kansl2 APN 15 98529446 missense probably damaging 1.00
R0004:Kansl2 UTSW 15 98520376 missense probably damaging 1.00
R1128:Kansl2 UTSW 15 98533685 nonsense probably null
R1129:Kansl2 UTSW 15 98533581 missense probably damaging 1.00
R2132:Kansl2 UTSW 15 98529397 missense probably damaging 1.00
R2144:Kansl2 UTSW 15 98526631 missense probably benign 0.00
R2232:Kansl2 UTSW 15 98524478 missense probably damaging 1.00
R2510:Kansl2 UTSW 15 98528861 critical splice donor site probably null
R3433:Kansl2 UTSW 15 98528861 critical splice donor site probably null
R4125:Kansl2 UTSW 15 98531755 missense possibly damaging 0.79
R4818:Kansl2 UTSW 15 98526661 missense possibly damaging 0.48
R4906:Kansl2 UTSW 15 98531890 missense possibly damaging 0.83
R4962:Kansl2 UTSW 15 98531843 missense probably benign 0.01
R5973:Kansl2 UTSW 15 98529425 missense probably damaging 1.00
R6014:Kansl2 UTSW 15 98520316 critical splice donor site probably null
R6077:Kansl2 UTSW 15 98531431 missense probably benign 0.08
R6657:Kansl2 UTSW 15 98524670 missense possibly damaging 0.67
R7168:Kansl2 UTSW 15 98529544 splice site probably null
R7418:Kansl2 UTSW 15 98531894 missense possibly damaging 0.95
R7530:Kansl2 UTSW 15 98529015 missense probably benign 0.01
R7957:Kansl2 UTSW 15 98524618 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGGATTTCAAAGCCAGAACTGCTCG -3'
(R):5'- GCCGGTCTTACAGCTAACAAGTCTC -3'

Sequencing Primer
(F):5'- atctgcctgcctctgcc -3'
(R):5'- tgagaagctgaggctaggg -3'
Posted On2014-02-18