Mutagenetix > Incidental Mutation

Incidental Mutation 'R1312:Dusp27'

157953

Institutional Source

Beutler Lab

Gene Symbol

Dusp27

Ensembl Gene

ENSMUSG00000026564

Gene Name

dual specificity phosphatase 27 (putative)

Synonyms

C130085G02Rik

MMRRC Submission

039378-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1312 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

166098148-166127922 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 166099291 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 917 (N917K)

Ref Sequence

ENSEMBL: ENSMUSP00000141564 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085992] [ENSMUST00000192369]

AlphaFold

Q148W8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000085992
AA Change: N917K

PolyPhen 2 Score 0.459 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000083155
Gene: ENSMUSG00000026564
AA Change: N917K

Domain	Start	End	E-Value	Type
low complexity region	6	20	N/A	INTRINSIC
DSPc	133	277	2.45e-30	SMART
low complexity region	339	348	N/A	INTRINSIC
low complexity region	404	425	N/A	INTRINSIC
low complexity region	429	439	N/A	INTRINSIC
low complexity region	618	635	N/A	INTRINSIC
low complexity region	655	666	N/A	INTRINSIC
low complexity region	773	788	N/A	INTRINSIC
coiled coil region	813	839	N/A	INTRINSIC
low complexity region	851	860	N/A	INTRINSIC
low complexity region	936	950	N/A	INTRINSIC
low complexity region	1001	1019	N/A	INTRINSIC
low complexity region	1026	1040	N/A	INTRINSIC
low complexity region	1074	1091	N/A	INTRINSIC
low complexity region	1108	1120	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000192369
AA Change: N917K

PolyPhen 2 Score 0.459 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000141564
Gene: ENSMUSG00000026564
AA Change: N917K

Domain	Start	End	E-Value	Type
low complexity region	6	20	N/A	INTRINSIC
DSPc	133	277	2.45e-30	SMART
low complexity region	339	348	N/A	INTRINSIC
low complexity region	404	425	N/A	INTRINSIC
low complexity region	429	439	N/A	INTRINSIC
low complexity region	618	635	N/A	INTRINSIC
low complexity region	655	666	N/A	INTRINSIC
low complexity region	773	788	N/A	INTRINSIC
coiled coil region	813	839	N/A	INTRINSIC
low complexity region	851	860	N/A	INTRINSIC
low complexity region	936	950	N/A	INTRINSIC
low complexity region	1001	1019	N/A	INTRINSIC
low complexity region	1026	1040	N/A	INTRINSIC
low complexity region	1074	1091	N/A	INTRINSIC
low complexity region	1108	1120	N/A	INTRINSIC

Meta Mutation Damage Score

0.2022

Coding Region Coverage

1x: 98.8%
3x: 97.7%
10x: 94.0%
20x: 85.7%

Validation Efficiency

98% (41/42)

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921539E11Rik	A	T	4: 103,270,797	F44I	probably damaging	Het
Acot10	A	G	15: 20,666,499	V52A	probably benign	Het
Arhgap32	T	C	9: 32,255,312	V415A	probably benign	Het
Cacna2d3	T	C	14: 29,045,668	D750G	probably benign	Het
Cdh15	G	A	8: 122,861,449		probably benign	Het
Edem2	T	G	2: 155,702,585	D415A	probably damaging	Het
Eml6	A	G	11: 29,831,219		probably benign	Het
Ercc5	T	C	1: 44,164,019	F272S	probably damaging	Het
Fcamr	C	T	1: 130,811,487	R175C	probably damaging	Het
Frem3	G	A	8: 80,615,322	V1415I	probably benign	Het
Fry	T	C	5: 150,403,432		probably benign	Het
Gm14443	A	T	2: 175,171,590		probably benign	Het
Insrr	A	G	3: 87,800,490	T80A	probably damaging	Het
Itih2	T	A	2: 10,097,924	T800S	probably benign	Het
Lgals9	G	A	11: 78,976,617	Q42*	probably null	Het
Lrrk2	A	G	15: 91,699,895	N286S	probably damaging	Het
Mefv	A	G	16: 3,708,534		probably benign	Het
Mkx	T	A	18: 6,937,192	D284V	probably benign	Het
Olfr743	T	A	14: 50,534,195	I261K	probably benign	Het
Pde1b	T	G	15: 103,526,273	S339A	possibly damaging	Het
Plch2	C	T	4: 154,989,799	V765M	probably damaging	Het
Ppp4r3b	A	T	11: 29,173,358	Q18L	probably benign	Het
Psme4	T	A	11: 30,807,687		probably null	Het
Pwp1	G	A	10: 85,879,309	D220N	probably damaging	Het
Rel	G	A	11: 23,757,010	T64I	probably damaging	Het
Rho	C	G	6: 115,935,605	N160K	probably damaging	Het
Skiv2l2	A	C	13: 112,883,251	L775*	probably null	Het
Sntb2	A	G	8: 107,001,577	T386A	probably damaging	Het
Sucla2	C	T	14: 73,560,634		probably benign	Het
Ttc30a2	A	T	2: 75,976,332	V612D	probably benign	Het
Vcp	T	C	4: 42,988,728	T249A	possibly damaging	Het
Vmn1r167	A	G	7: 23,505,123	F156S	probably benign	Het
Vrk2	G	A	11: 26,535,522		probably benign	Het
Zfp407	C	T	18: 84,559,773	A1072T	probably benign	Het
Zfp638	A	G	6: 83,929,041	N63D	probably damaging	Het

Other mutations in Dusp27

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00706:Dusp27	APN	1	166100552	missense	probably benign	0.00
IGL00973:Dusp27	APN	1	166099458	missense	probably benign
IGL01331:Dusp27	APN	1	166108180	missense	probably damaging	1.00
IGL01466:Dusp27	APN	1	166100504	missense	probably damaging	1.00
IGL01572:Dusp27	APN	1	166100372	missense	probably benign	0.18
IGL01906:Dusp27	APN	1	166099523	missense	probably damaging	1.00
IGL01974:Dusp27	APN	1	166100536	nonsense	probably null
IGL02112:Dusp27	APN	1	166099671	nonsense	probably null
IGL02805:Dusp27	APN	1	166099061	missense	probably damaging	1.00
IGL03343:Dusp27	APN	1	166099448	missense	probably benign	0.00
R0116:Dusp27	UTSW	1	166099701	missense	probably benign	0.19
R0367:Dusp27	UTSW	1	166100763	missense	probably benign	0.05
R0499:Dusp27	UTSW	1	166099101	missense	probably benign	0.00
R0542:Dusp27	UTSW	1	166101284	missense	possibly damaging	0.90
R1572:Dusp27	UTSW	1	166099455	missense	possibly damaging	0.68
R1598:Dusp27	UTSW	1	166110259	missense	probably benign	0.10
R1858:Dusp27	UTSW	1	166100846	missense	possibly damaging	0.87
R2021:Dusp27	UTSW	1	166100823	missense	probably benign	0.00
R2970:Dusp27	UTSW	1	166099229	missense	probably benign	0.04
R3727:Dusp27	UTSW	1	166099506	missense	probably damaging	1.00
R4041:Dusp27	UTSW	1	166100111	missense	probably benign	0.01
R4245:Dusp27	UTSW	1	166101116	missense	probably damaging	1.00
R4955:Dusp27	UTSW	1	166108092	missense	probably damaging	1.00
R4967:Dusp27	UTSW	1	166127106	missense	probably damaging	1.00
R5040:Dusp27	UTSW	1	166100345	missense	probably benign	0.17
R5342:Dusp27	UTSW	1	166110250	missense	probably benign	0.01
R5467:Dusp27	UTSW	1	166112030	critical splice donor site	probably null
R5742:Dusp27	UTSW	1	166099454	missense	probably benign	0.00
R6222:Dusp27	UTSW	1	166098645	missense	probably benign	0.26
R6239:Dusp27	UTSW	1	166098819	missense	probably damaging	1.00
R6531:Dusp27	UTSW	1	166110046	splice site	probably null
R6586:Dusp27	UTSW	1	166100885	missense	possibly damaging	0.79
R6958:Dusp27	UTSW	1	166107996	missense	probably damaging	1.00
R7006:Dusp27	UTSW	1	166099094	missense	probably benign
R7111:Dusp27	UTSW	1	166127154	missense	possibly damaging	0.66
R7310:Dusp27	UTSW	1	166098731	missense	possibly damaging	0.46
R7312:Dusp27	UTSW	1	166127107	missense	probably damaging	0.99
R7378:Dusp27	UTSW	1	166112063	nonsense	probably null
R7398:Dusp27	UTSW	1	166100475	missense	probably damaging	1.00
R7442:Dusp27	UTSW	1	166101015	missense	probably benign	0.01
R7569:Dusp27	UTSW	1	166108035	missense	probably damaging	1.00
R7920:Dusp27	UTSW	1	166099896	missense	possibly damaging	0.72
R7954:Dusp27	UTSW	1	166099280	missense	probably benign	0.05
R7972:Dusp27	UTSW	1	166099139	missense	probably damaging	1.00
R8186:Dusp27	UTSW	1	166100079	missense	probably damaging	1.00
R8354:Dusp27	UTSW	1	166108133	missense	probably damaging	1.00
R8454:Dusp27	UTSW	1	166108133	missense	probably damaging	1.00
R8535:Dusp27	UTSW	1	166101161	missense	probably benign	0.01
R9419:Dusp27	UTSW	1	166100186	missense	probably damaging	1.00
R9493:Dusp27	UTSW	1	166098841	missense	probably damaging	1.00
R9694:Dusp27	UTSW	1	166101085	missense	probably damaging	1.00
Z1088:Dusp27	UTSW	1	166099283	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCGCACAGTGTCACCATTGGCTTC -3'
(R):5'- TGGCCTCTGATAACAAGCGTAGCTC -3'

Sequencing Primer
(F):5'- ACCATTGGCTTCGTGGAAGG -3'
(R):5'- TAACAAGCGTAGCTCTCTCTTCAAG -3'

Posted On

2014-02-18