Incidental Mutation 'R1312:Ttc30a2'
ID157955
Institutional Source Beutler Lab
Gene Symbol Ttc30a2
Ensembl Gene ENSMUSG00000075272
Gene Nametetratricopeptide repeat domain 30A2
SynonymsOTTMUSG00000015167
MMRRC Submission 039378-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1312 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location75975740-75978170 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 75976332 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 612 (V612D)
Ref Sequence ENSEMBL: ENSMUSP00000097575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099994] [ENSMUST00000099995]
Predicted Effect probably benign
Transcript: ENSMUST00000099994
SMART Domains Protein: ENSMUSP00000097574
Gene: ENSMUSG00000075271

DomainStartEndE-ValueType
TPR 45 78 1.1e-1 SMART
TPR 153 186 2.19e1 SMART
TPR 187 220 6.24e1 SMART
coiled coil region 380 411 N/A INTRINSIC
TPR 423 456 2.24e1 SMART
Blast:TPR 457 491 1e-10 BLAST
low complexity region 514 528 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099995
AA Change: V612D

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000097575
Gene: ENSMUSG00000075272
AA Change: V612D

DomainStartEndE-ValueType
TPR 45 78 1.1e-1 SMART
TPR 153 186 2.77e1 SMART
Blast:TPR 187 224 1e-13 BLAST
coiled coil region 380 405 N/A INTRINSIC
TPR 423 456 2.24e1 SMART
Blast:TPR 457 491 1e-10 BLAST
low complexity region 514 528 N/A INTRINSIC
Meta Mutation Damage Score 0.172 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.0%
  • 20x: 85.7%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik A T 4: 103,270,797 F44I probably damaging Het
Acot10 A G 15: 20,666,499 V52A probably benign Het
Arhgap32 T C 9: 32,255,312 V415A probably benign Het
Cacna2d3 T C 14: 29,045,668 D750G probably benign Het
Cdh15 G A 8: 122,861,449 probably benign Het
Dusp27 A T 1: 166,099,291 N917K possibly damaging Het
Edem2 T G 2: 155,702,585 D415A probably damaging Het
Eml6 A G 11: 29,831,219 probably benign Het
Ercc5 T C 1: 44,164,019 F272S probably damaging Het
Fcamr C T 1: 130,811,487 R175C probably damaging Het
Frem3 G A 8: 80,615,322 V1415I probably benign Het
Fry T C 5: 150,403,432 probably benign Het
Gm14443 A T 2: 175,171,590 probably benign Het
Insrr A G 3: 87,800,490 T80A probably damaging Het
Itih2 T A 2: 10,097,924 T800S probably benign Het
Lgals9 G A 11: 78,976,617 Q42* probably null Het
Lrrk2 A G 15: 91,699,895 N286S probably damaging Het
Mefv A G 16: 3,708,534 probably benign Het
Mkx T A 18: 6,937,192 D284V probably benign Het
Olfr743 T A 14: 50,534,195 I261K probably benign Het
Pde1b T G 15: 103,526,273 S339A possibly damaging Het
Plch2 C T 4: 154,989,799 V765M probably damaging Het
Ppp4r3b A T 11: 29,173,358 Q18L probably benign Het
Psme4 T A 11: 30,807,687 probably null Het
Pwp1 G A 10: 85,879,309 D220N probably damaging Het
Rel G A 11: 23,757,010 T64I probably damaging Het
Rho C G 6: 115,935,605 N160K probably damaging Het
Skiv2l2 A C 13: 112,883,251 L775* probably null Het
Sntb2 A G 8: 107,001,577 T386A probably damaging Het
Sucla2 C T 14: 73,560,634 probably benign Het
Vcp T C 4: 42,988,728 T249A possibly damaging Het
Vmn1r167 A G 7: 23,505,123 F156S probably benign Het
Vrk2 G A 11: 26,535,522 probably benign Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp638 A G 6: 83,929,041 N63D probably damaging Het
Other mutations in Ttc30a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02724:Ttc30a2 APN 2 75976338 missense probably benign 0.16
IGL03269:Ttc30a2 APN 2 75978135 missense possibly damaging 0.50
R0011:Ttc30a2 UTSW 2 75976217 missense probably damaging 1.00
R0751:Ttc30a2 UTSW 2 75978031 missense probably damaging 0.99
R0766:Ttc30a2 UTSW 2 75976332 missense probably benign 0.00
R0835:Ttc30a2 UTSW 2 75978150 missense probably benign
R1133:Ttc30a2 UTSW 2 75977383 nonsense probably null
R1212:Ttc30a2 UTSW 2 75976479 missense probably damaging 1.00
R4780:Ttc30a2 UTSW 2 75977576 missense probably benign 0.19
R4799:Ttc30a2 UTSW 2 75977385 missense probably benign 0.01
R4847:Ttc30a2 UTSW 2 75977714 missense probably benign 0.03
R5176:Ttc30a2 UTSW 2 75977077 missense probably benign
R5390:Ttc30a2 UTSW 2 75977286 missense probably damaging 1.00
R5724:Ttc30a2 UTSW 2 75977730 missense probably benign
R6975:Ttc30a2 UTSW 2 75976408 missense probably damaging 1.00
R6975:Ttc30a2 UTSW 2 75977660 nonsense probably null
R7028:Ttc30a2 UTSW 2 75976269 nonsense probably null
R7234:Ttc30a2 UTSW 2 75976196 nonsense probably null
R7246:Ttc30a2 UTSW 2 75977679 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCATTGCAGCAACTGAGGAC -3'
(R):5'- AGGAACCCTGTATTGTGCCAAAGG -3'

Sequencing Primer
(F):5'- CTGTGTCGAGTCGTAAAAATGC -3'
(R):5'- GGAAACTATGACTTTGGCATCTCTC -3'
Posted On2014-02-18