Incidental Mutation 'R1312:Vcp'
ID157959
Institutional Source Beutler Lab
Gene Symbol Vcp
Ensembl Gene ENSMUSG00000028452
Gene Namevalosin containing protein
SynonymsAAA ATPase p97, p97/VCP, p97, CDC48
MMRRC Submission 039378-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1312 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location42979963-43000507 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 42988728 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 249 (T249A)
Ref Sequence ENSEMBL: ENSMUSP00000030164 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030164]
PDB Structure
STRUCTURE OF THE N-TERMINAL DOMAIN AND THE D1 AAA DOMAIN OF MEMBRANE FUSION ATPASE P97 [X-RAY DIFFRACTION]
The crystal structure of murine p97/VCP at 3.6A [X-RAY DIFFRACTION]
Crystal structure of AAA ATPase p97/VCP ND1 in complex with p47 C [X-RAY DIFFRACTION]
Strctural Model of the p97 N domain- npl4 UBD complex [SOLUTION NMR]
Structure of D2 subdomain of P97/VCP in complex with ADP [X-RAY DIFFRACTION]
Structure of P97/vcp in complex with ADP/ADP.alfx [X-RAY DIFFRACTION]
Structure of P97/vcp in complex with ADP/AMP-PNP [X-RAY DIFFRACTION]
Structure of P97/vcp in complex with ADP [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030164
AA Change: T249A

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000030164
Gene: ENSMUSG00000028452
AA Change: T249A

DomainStartEndE-ValueType
CDC48_N 25 108 6.85e-27 SMART
CDC48_2 125 191 3.77e-15 SMART
AAA 237 373 7.87e-24 SMART
AAA 510 649 2e-25 SMART
Pfam:Vps4_C 710 762 3.5e-7 PFAM
low complexity region 775 794 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139843
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148182
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154423
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154541
Meta Mutation Damage Score 0.7721 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.0%
  • 20x: 85.7%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a family that includes putative ATP-binding proteins involved in vesicle transport and fusion, 26S proteasome function, and assembly of peroxisomes. This protein, as a structural protein, is associated with clathrin, and heat-shock protein Hsc70, to form a complex. It has been implicated in a number of cellular events that are regulated during mitosis, including homotypic membrane fusion, spindle pole body function, and ubiquitin-dependent protein degradation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in lethality before weaning. Mice homozygous for a knock-in allele exhibit progressive muscle weakness, myopathy, decreased bone density, increased osteoclast genesis, and seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik A T 4: 103,270,797 F44I probably damaging Het
Acot10 A G 15: 20,666,499 V52A probably benign Het
Arhgap32 T C 9: 32,255,312 V415A probably benign Het
Cacna2d3 T C 14: 29,045,668 D750G probably benign Het
Cdh15 G A 8: 122,861,449 probably benign Het
Dusp27 A T 1: 166,099,291 N917K possibly damaging Het
Edem2 T G 2: 155,702,585 D415A probably damaging Het
Eml6 A G 11: 29,831,219 probably benign Het
Ercc5 T C 1: 44,164,019 F272S probably damaging Het
Fcamr C T 1: 130,811,487 R175C probably damaging Het
Frem3 G A 8: 80,615,322 V1415I probably benign Het
Fry T C 5: 150,403,432 probably benign Het
Gm14443 A T 2: 175,171,590 probably benign Het
Insrr A G 3: 87,800,490 T80A probably damaging Het
Itih2 T A 2: 10,097,924 T800S probably benign Het
Lgals9 G A 11: 78,976,617 Q42* probably null Het
Lrrk2 A G 15: 91,699,895 N286S probably damaging Het
Mefv A G 16: 3,708,534 probably benign Het
Mkx T A 18: 6,937,192 D284V probably benign Het
Olfr743 T A 14: 50,534,195 I261K probably benign Het
Pde1b T G 15: 103,526,273 S339A possibly damaging Het
Plch2 C T 4: 154,989,799 V765M probably damaging Het
Ppp4r3b A T 11: 29,173,358 Q18L probably benign Het
Psme4 T A 11: 30,807,687 probably null Het
Pwp1 G A 10: 85,879,309 D220N probably damaging Het
Rel G A 11: 23,757,010 T64I probably damaging Het
Rho C G 6: 115,935,605 N160K probably damaging Het
Skiv2l2 A C 13: 112,883,251 L775* probably null Het
Sntb2 A G 8: 107,001,577 T386A probably damaging Het
Sucla2 C T 14: 73,560,634 probably benign Het
Ttc30a2 A T 2: 75,976,332 V612D probably benign Het
Vmn1r167 A G 7: 23,505,123 F156S probably benign Het
Vrk2 G A 11: 26,535,522 probably benign Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp638 A G 6: 83,929,041 N63D probably damaging Het
Other mutations in Vcp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01460:Vcp APN 4 42996040 missense possibly damaging 0.69
IGL02251:Vcp APN 4 42988728 missense possibly damaging 0.49
H8562:Vcp UTSW 4 42982596 missense probably damaging 1.00
R0627:Vcp UTSW 4 42983011 missense possibly damaging 0.83
R0639:Vcp UTSW 4 42982565 missense probably benign 0.00
R0711:Vcp UTSW 4 42986201 missense probably benign 0.22
R0766:Vcp UTSW 4 42988728 missense possibly damaging 0.49
R1702:Vcp UTSW 4 42990840 missense probably damaging 1.00
R2071:Vcp UTSW 4 42995894 critical splice donor site probably null
R2192:Vcp UTSW 4 42982547 missense probably benign
R2262:Vcp UTSW 4 42980828 missense probably benign 0.04
R2265:Vcp UTSW 4 42980833 missense possibly damaging 0.93
R2268:Vcp UTSW 4 42980833 missense possibly damaging 0.93
R2269:Vcp UTSW 4 42980833 missense possibly damaging 0.93
R2443:Vcp UTSW 4 42983385 missense probably damaging 1.00
R2937:Vcp UTSW 4 42980846 missense probably damaging 1.00
R2973:Vcp UTSW 4 42996315 missense probably damaging 1.00
R4004:Vcp UTSW 4 42983028 missense probably damaging 1.00
R4488:Vcp UTSW 4 42993826 missense probably damaging 0.96
R4546:Vcp UTSW 4 42988813 intron probably benign
R4578:Vcp UTSW 4 42984565 missense probably benign 0.41
R4817:Vcp UTSW 4 42983486 missense probably damaging 1.00
R4869:Vcp UTSW 4 42993691 missense probably benign 0.00
R5014:Vcp UTSW 4 42980828 missense probably benign 0.04
R6128:Vcp UTSW 4 42980941 missense probably benign 0.00
R6594:Vcp UTSW 4 42993826 missense probably damaging 0.96
R7105:Vcp UTSW 4 42985991 missense probably damaging 1.00
R7470:Vcp UTSW 4 42982891 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATGCTGAAGGGTATAGGTGCAGGTGAA -3'
(R):5'- CCCATTGTAAATCATTCTGGCCTCAAGT -3'

Sequencing Primer
(F):5'- GAATGTTTCCATGAGTTGCCTAAC -3'
(R):5'- agagaccagaagaagacatcag -3'
Posted On2014-02-18