Incidental Mutation 'R1312:Rho'
ID157963
Institutional Source Beutler Lab
Gene Symbol Rho
Ensembl Gene ENSMUSG00000030324
Gene Namerhodopsin
SynonymsNoerg1, Ops, RP4, Long Wavelength Sensitive opsin, opsin 2, L opsin, LWS opsin, Red Opsin, Opn2, Rod Opsin
MMRRC Submission 039378-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R1312 (G1)
Quality Score139
Status Validated
Chromosome6
Chromosomal Location115931748-115940036 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 115935605 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 160 (N160K)
Ref Sequence ENSEMBL: ENSMUSP00000144768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032471] [ENSMUST00000203877] [ENSMUST00000204493] [ENSMUST00000204711]
Predicted Effect probably damaging
Transcript: ENSMUST00000032471
AA Change: N302K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032471
Gene: ENSMUSG00000030324
AA Change: N302K

DomainStartEndE-ValueType
Pfam:Rhodopsin_N 2 37 1e-23 PFAM
Pfam:7TM_GPCR_Srv 40 323 1.2e-12 PFAM
Pfam:7TM_GPCR_Srw 42 324 7.9e-12 PFAM
Pfam:7TM_GPCR_Srsx 48 321 4.9e-11 PFAM
Pfam:7tm_1 54 306 5.1e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203284
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203323
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203531
Predicted Effect probably damaging
Transcript: ENSMUST00000203877
AA Change: N143K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144952
Gene: ENSMUSG00000030324
AA Change: N143K

DomainStartEndE-ValueType
Pfam:7tm_1 6 147 1.6e-17 PFAM
Pfam:7TM_GPCR_Srw 19 165 1.2e-8 PFAM
Pfam:7TM_GPCR_Srsx 25 162 1.2e-4 PFAM
Pfam:7TM_GPCR_Srv 29 164 7.3e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203894
Predicted Effect probably benign
Transcript: ENSMUST00000204493
SMART Domains Protein: ENSMUSP00000145464
Gene: ENSMUSG00000030324

DomainStartEndE-ValueType
low complexity region 20 41 N/A INTRINSIC
low complexity region 48 54 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000204711
AA Change: N160K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144768
Gene: ENSMUSG00000030324
AA Change: N160K

DomainStartEndE-ValueType
Pfam:7tm_1 1 164 4.1e-24 PFAM
Pfam:7TM_GPCR_Srw 11 182 5.4e-9 PFAM
Pfam:7TM_GPCR_Srv 13 181 1.6e-7 PFAM
Meta Mutation Damage Score 0.9175 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.0%
  • 20x: 85.7%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Retinitis pigmentosa is an inherited progressive disease which is a major cause of blindness in western communities. It can be inherited as an autosomal dominant, autosomal recessive, or X-linked recessive disorder. In the autosomal dominant form,which comprises about 25% of total cases, approximately 30% of families have mutations in the gene encoding the rod photoreceptor-specific protein rhodopsin. This is the transmembrane protein which, when photoexcited, initiates the visual transduction cascade. Defects in this gene are also one of the causes of congenital stationary night blindness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted null homozygotes fail to develop retinal rod outer segments and lose their photoreceptors while heterozygotes exhibit some disorganization of their photoreceptors and a shortening of the outer segments with age. Some point mutants have only light-induced photoreceptor degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik A T 4: 103,270,797 F44I probably damaging Het
Acot10 A G 15: 20,666,499 V52A probably benign Het
Arhgap32 T C 9: 32,255,312 V415A probably benign Het
Cacna2d3 T C 14: 29,045,668 D750G probably benign Het
Cdh15 G A 8: 122,861,449 probably benign Het
Dusp27 A T 1: 166,099,291 N917K possibly damaging Het
Edem2 T G 2: 155,702,585 D415A probably damaging Het
Eml6 A G 11: 29,831,219 probably benign Het
Ercc5 T C 1: 44,164,019 F272S probably damaging Het
Fcamr C T 1: 130,811,487 R175C probably damaging Het
Frem3 G A 8: 80,615,322 V1415I probably benign Het
Fry T C 5: 150,403,432 probably benign Het
Gm14443 A T 2: 175,171,590 probably benign Het
Insrr A G 3: 87,800,490 T80A probably damaging Het
Itih2 T A 2: 10,097,924 T800S probably benign Het
Lgals9 G A 11: 78,976,617 Q42* probably null Het
Lrrk2 A G 15: 91,699,895 N286S probably damaging Het
Mefv A G 16: 3,708,534 probably benign Het
Mkx T A 18: 6,937,192 D284V probably benign Het
Olfr743 T A 14: 50,534,195 I261K probably benign Het
Pde1b T G 15: 103,526,273 S339A possibly damaging Het
Plch2 C T 4: 154,989,799 V765M probably damaging Het
Ppp4r3b A T 11: 29,173,358 Q18L probably benign Het
Psme4 T A 11: 30,807,687 probably null Het
Pwp1 G A 10: 85,879,309 D220N probably damaging Het
Rel G A 11: 23,757,010 T64I probably damaging Het
Skiv2l2 A C 13: 112,883,251 L775* probably null Het
Sntb2 A G 8: 107,001,577 T386A probably damaging Het
Sucla2 C T 14: 73,560,634 probably benign Het
Ttc30a2 A T 2: 75,976,332 V612D probably benign Het
Vcp T C 4: 42,988,728 T249A possibly damaging Het
Vmn1r167 A G 7: 23,505,123 F156S probably benign Het
Vrk2 G A 11: 26,535,522 probably benign Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp638 A G 6: 83,929,041 N63D probably damaging Het
Other mutations in Rho
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02432:Rho APN 6 115932185 missense probably damaging 0.99
IGL02480:Rho APN 6 115935544 missense probably benign 0.20
IGL02625:Rho APN 6 115935197 missense possibly damaging 0.95
bemr3 UTSW 6 115935131 missense probably damaging 1.00
R0165:Rho UTSW 6 115932227 missense probably damaging 1.00
R1167:Rho UTSW 6 115935423 missense probably damaging 0.98
R1169:Rho UTSW 6 115932238 missense probably damaging 1.00
R2393:Rho UTSW 6 115935391 splice site probably benign
R3895:Rho UTSW 6 115933902 missense probably damaging 1.00
R4414:Rho UTSW 6 115935230 missense probably benign
R4416:Rho UTSW 6 115935230 missense probably benign
R5753:Rho UTSW 6 115935487 missense probably damaging 1.00
R6483:Rho UTSW 6 115932257 missense possibly damaging 0.78
R6552:Rho UTSW 6 115931748 splice site probably null
R6719:Rho UTSW 6 115933893 missense possibly damaging 0.58
R7030:Rho UTSW 6 115935543 missense possibly damaging 0.93
R7354:Rho UTSW 6 115935503 nonsense probably null
R7566:Rho UTSW 6 115932174 missense probably damaging 1.00
R7674:Rho UTSW 6 115932333 missense probably damaging 1.00
R7699:Rho UTSW 6 115935239 missense probably damaging 0.98
R7700:Rho UTSW 6 115935239 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCAAGCCTGAGGTCAACAACGAATC -3'
(R):5'- TCACCCGGAAGACTTACTCCAAGAG -3'

Sequencing Primer
(F):5'- AGCTGGTCTTCACAGTCAAG -3'
(R):5'- CCAAGAGCTTGGGGGTTCG -3'
Posted On2014-02-18