Incidental Mutation 'R1312:Rel'
ID157970
Institutional Source Beutler Lab
Gene Symbol Rel
Ensembl Gene ENSMUSG00000020275
Gene Namereticuloendotheliosis oncogene
Synonymsc-Rel
MMRRC Submission 039378-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1312 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location23736847-23770970 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 23757010 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 64 (T64I)
Ref Sequence ENSEMBL: ENSMUSP00000099928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102864]
Predicted Effect probably damaging
Transcript: ENSMUST00000102864
AA Change: T64I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099928
Gene: ENSMUSG00000020275
AA Change: T64I

DomainStartEndE-ValueType
Pfam:RHD_DNA_bind 10 178 8.1e-78 PFAM
IPT 185 280 7.64e-24 SMART
low complexity region 512 530 N/A INTRINSIC
Meta Mutation Damage Score 0.7378 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.0%
  • 20x: 85.7%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the Rel homology domain/immunoglobulin-like fold, plexin, transcription factor (RHD/IPT) family. Members of this family regulate genes involved in apoptosis, inflammation, the immune response, and oncogenic processes. This proto-oncogene plays a role in the survival and proliferation of B lymphocytes. Mutation or amplification of this gene is associated with B-cell lymphomas, including Hodgkin's lymphoma. Single nucleotide polymorphisms in this gene are associated with susceptibility to ulcerative colitis and rheumatoid arthritis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygous inactivation of this gene causes defects in lymphocyte proliferation, humoral immunity and cytokine production, and may lead to impaired Th1 responses and resistance to autoimmune disease. Mice lacking only the COOH-terminal region show severehemopoietic defects and lymphoid hyperplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik A T 4: 103,270,797 F44I probably damaging Het
Acot10 A G 15: 20,666,499 V52A probably benign Het
Arhgap32 T C 9: 32,255,312 V415A probably benign Het
Cacna2d3 T C 14: 29,045,668 D750G probably benign Het
Cdh15 G A 8: 122,861,449 probably benign Het
Dusp27 A T 1: 166,099,291 N917K possibly damaging Het
Edem2 T G 2: 155,702,585 D415A probably damaging Het
Eml6 A G 11: 29,831,219 probably benign Het
Ercc5 T C 1: 44,164,019 F272S probably damaging Het
Fcamr C T 1: 130,811,487 R175C probably damaging Het
Frem3 G A 8: 80,615,322 V1415I probably benign Het
Fry T C 5: 150,403,432 probably benign Het
Gm14443 A T 2: 175,171,590 probably benign Het
Insrr A G 3: 87,800,490 T80A probably damaging Het
Itih2 T A 2: 10,097,924 T800S probably benign Het
Lgals9 G A 11: 78,976,617 Q42* probably null Het
Lrrk2 A G 15: 91,699,895 N286S probably damaging Het
Mefv A G 16: 3,708,534 probably benign Het
Mkx T A 18: 6,937,192 D284V probably benign Het
Olfr743 T A 14: 50,534,195 I261K probably benign Het
Pde1b T G 15: 103,526,273 S339A possibly damaging Het
Plch2 C T 4: 154,989,799 V765M probably damaging Het
Ppp4r3b A T 11: 29,173,358 Q18L probably benign Het
Psme4 T A 11: 30,807,687 probably null Het
Pwp1 G A 10: 85,879,309 D220N probably damaging Het
Rho C G 6: 115,935,605 N160K probably damaging Het
Skiv2l2 A C 13: 112,883,251 L775* probably null Het
Sntb2 A G 8: 107,001,577 T386A probably damaging Het
Sucla2 C T 14: 73,560,634 probably benign Het
Ttc30a2 A T 2: 75,976,332 V612D probably benign Het
Vcp T C 4: 42,988,728 T249A possibly damaging Het
Vmn1r167 A G 7: 23,505,123 F156S probably benign Het
Vrk2 G A 11: 26,535,522 probably benign Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp638 A G 6: 83,929,041 N63D probably damaging Het
Other mutations in Rel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00663:Rel APN 11 23757043 missense probably benign 0.31
IGL00819:Rel APN 11 23743029 missense probably benign 0.13
IGL00906:Rel APN 11 23744266 missense probably benign 0.00
IGL01358:Rel APN 11 23761155 missense probably benign 0.06
IGL01820:Rel APN 11 23753218 missense probably benign 0.22
IGL01889:Rel APN 11 23757035 missense probably damaging 0.96
IGL03270:Rel APN 11 23742584 missense probably benign 0.16
Amun-ra UTSW 11 23757026 nonsense probably null
Fleur UTSW 11 unclassified
giza UTSW 11 23757010 missense probably damaging 1.00
Horus UTSW 11 23753215 critical splice donor site probably null
R0766:Rel UTSW 11 23757010 missense probably damaging 1.00
R0924:Rel UTSW 11 23742439 missense probably benign 0.02
R0930:Rel UTSW 11 23742439 missense probably benign 0.02
R1339:Rel UTSW 11 23745763 missense probably damaging 1.00
R1584:Rel UTSW 11 23745546 missense probably damaging 1.00
R1980:Rel UTSW 11 23742761 missense probably benign
R1981:Rel UTSW 11 23742761 missense probably benign
R1982:Rel UTSW 11 23742761 missense probably benign
R2513:Rel UTSW 11 23745823 missense probably damaging 1.00
R2870:Rel UTSW 11 23761129 missense probably benign
R2870:Rel UTSW 11 23761129 missense probably benign
R2871:Rel UTSW 11 23761129 missense probably benign
R2871:Rel UTSW 11 23761129 missense probably benign
R2872:Rel UTSW 11 23761129 missense probably benign
R2872:Rel UTSW 11 23761129 missense probably benign
R3617:Rel UTSW 11 23745780 missense probably damaging 1.00
R3976:Rel UTSW 11 23742939 missense probably benign 0.07
R4010:Rel UTSW 11 23761138 missense probably benign
R4067:Rel UTSW 11 23753215 critical splice donor site probably null
R5345:Rel UTSW 11 23742462 missense probably benign 0.00
R5866:Rel UTSW 11 23742724 nonsense probably null
R6032:Rel UTSW 11 23742684 missense probably benign 0.02
R6032:Rel UTSW 11 23742684 missense probably benign 0.02
R6562:Rel UTSW 11 23757026 nonsense probably null
R6886:Rel UTSW 11 23744304 missense probably benign 0.03
R7516:Rel UTSW 11 23742785 missense probably benign 0.00
R7522:Rel UTSW 11 23770676 splice site probably null
R7663:Rel UTSW 11 23742713 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCTCCCCACAGGTAACAAAGTGT -3'
(R):5'- caccataatgcctggcCTGCTTA -3'

Sequencing Primer
(F):5'- AACAAAGGTCTGCGTTCTGG -3'
(R):5'- aggggcattattgtaggtagc -3'
Posted On2014-02-18