Incidental Mutation 'R1312:Lgals9'
ID157974
Institutional Source Beutler Lab
Gene Symbol Lgals9
Ensembl Gene ENSMUSG00000001123
Gene Namelectin, galactose binding, soluble 9
SynonymsLgals5, galectin-9, LGALS35, gal-9
MMRRC Submission 039378-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R1312 (G1)
Quality Score160
Status Validated
Chromosome11
Chromosomal Location78962974-78984946 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 78976617 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 42 (Q42*)
Ref Sequence ENSEMBL: ENSMUSP00000103904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073001] [ENSMUST00000108268] [ENSMUST00000108269]
Predicted Effect probably null
Transcript: ENSMUST00000073001
AA Change: Q42*
SMART Domains Protein: ENSMUSP00000072764
Gene: ENSMUSG00000001123
AA Change: Q42*

DomainStartEndE-ValueType
GLECT 15 147 6.58e-55 SMART
Gal-bind_lectin 21 146 5.24e-55 SMART
GLECT 222 352 5.38e-60 SMART
Gal-bind_lectin 228 352 1.33e-65 SMART
Predicted Effect probably null
Transcript: ENSMUST00000108268
AA Change: Q42*
SMART Domains Protein: ENSMUSP00000103903
Gene: ENSMUSG00000001123
AA Change: Q42*

DomainStartEndE-ValueType
GLECT 15 147 6.58e-55 SMART
Gal-bind_lectin 21 146 5.24e-55 SMART
GLECT 192 322 5.38e-60 SMART
Gal-bind_lectin 198 322 1.33e-65 SMART
Predicted Effect probably null
Transcript: ENSMUST00000108269
AA Change: Q42*
SMART Domains Protein: ENSMUSP00000103904
Gene: ENSMUSG00000001123
AA Change: Q42*

DomainStartEndE-ValueType
GLECT 15 147 6.58e-55 SMART
Gal-bind_lectin 21 146 5.24e-55 SMART
GLECT 223 353 5.38e-60 SMART
Gal-bind_lectin 229 353 1.33e-65 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.0%
  • 20x: 85.7%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was initially thought to represent a pseudogene of galectin 9; however, this transcript has good exon-intron structure and encodes a predicted protein of the same size as and highly similar to galectin 9. This gene is one of two similar loci on chromosome 17p similar to galectin 9 and now thought to be protein-encoding. This gene is the more centromeric gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit increased susceptibility to collagen-induced arthritis, increased T-helper 1 cells and decreased regulatory T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik A T 4: 103,270,797 F44I probably damaging Het
Acot10 A G 15: 20,666,499 V52A probably benign Het
Arhgap32 T C 9: 32,255,312 V415A probably benign Het
Cacna2d3 T C 14: 29,045,668 D750G probably benign Het
Cdh15 G A 8: 122,861,449 probably benign Het
Dusp27 A T 1: 166,099,291 N917K possibly damaging Het
Edem2 T G 2: 155,702,585 D415A probably damaging Het
Eml6 A G 11: 29,831,219 probably benign Het
Ercc5 T C 1: 44,164,019 F272S probably damaging Het
Fcamr C T 1: 130,811,487 R175C probably damaging Het
Frem3 G A 8: 80,615,322 V1415I probably benign Het
Fry T C 5: 150,403,432 probably benign Het
Gm14443 A T 2: 175,171,590 probably benign Het
Insrr A G 3: 87,800,490 T80A probably damaging Het
Itih2 T A 2: 10,097,924 T800S probably benign Het
Lrrk2 A G 15: 91,699,895 N286S probably damaging Het
Mefv A G 16: 3,708,534 probably benign Het
Mkx T A 18: 6,937,192 D284V probably benign Het
Olfr743 T A 14: 50,534,195 I261K probably benign Het
Pde1b T G 15: 103,526,273 S339A possibly damaging Het
Plch2 C T 4: 154,989,799 V765M probably damaging Het
Ppp4r3b A T 11: 29,173,358 Q18L probably benign Het
Psme4 T A 11: 30,807,687 probably null Het
Pwp1 G A 10: 85,879,309 D220N probably damaging Het
Rel G A 11: 23,757,010 T64I probably damaging Het
Rho C G 6: 115,935,605 N160K probably damaging Het
Skiv2l2 A C 13: 112,883,251 L775* probably null Het
Sntb2 A G 8: 107,001,577 T386A probably damaging Het
Sucla2 C T 14: 73,560,634 probably benign Het
Ttc30a2 A T 2: 75,976,332 V612D probably benign Het
Vcp T C 4: 42,988,728 T249A possibly damaging Het
Vmn1r167 A G 7: 23,505,123 F156S probably benign Het
Vrk2 G A 11: 26,535,522 probably benign Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp638 A G 6: 83,929,041 N63D probably damaging Het
Other mutations in Lgals9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Lgals9 APN 11 78973151 missense probably damaging 1.00
IGL01415:Lgals9 APN 11 78973151 missense probably damaging 1.00
IGL02194:Lgals9 APN 11 78966920 critical splice acceptor site probably null
IGL02390:Lgals9 APN 11 78963535 missense probably damaging 1.00
IGL02987:Lgals9 APN 11 78967477 missense possibly damaging 0.93
IGL03288:Lgals9 APN 11 78984800 missense probably benign 0.01
IGL03388:Lgals9 APN 11 78963421 missense probably damaging 0.99
R0057:Lgals9 UTSW 11 78971436 splice site probably benign
R0143:Lgals9 UTSW 11 78963535 missense probably damaging 1.00
R0325:Lgals9 UTSW 11 78963448 missense probably damaging 0.99
R0522:Lgals9 UTSW 11 78965812 missense possibly damaging 0.95
R0542:Lgals9 UTSW 11 78969720 missense possibly damaging 0.68
R0673:Lgals9 UTSW 11 78965853 missense probably damaging 1.00
R2000:Lgals9 UTSW 11 78973170 missense probably benign 0.01
R4083:Lgals9 UTSW 11 78969763 missense possibly damaging 0.63
R4084:Lgals9 UTSW 11 78969763 missense possibly damaging 0.63
R4157:Lgals9 UTSW 11 78973107 missense possibly damaging 0.88
R4204:Lgals9 UTSW 11 78969816 splice site probably benign
R4892:Lgals9 UTSW 11 78966083 missense probably benign 0.00
R5650:Lgals9 UTSW 11 78973154 missense probably damaging 0.97
R6155:Lgals9 UTSW 11 78963505 missense probably benign 0.16
R6166:Lgals9 UTSW 11 78971358 missense probably benign 0.14
R6405:Lgals9 UTSW 11 78971385 missense probably benign 0.42
R6853:Lgals9 UTSW 11 78966006 missense probably benign 0.16
R8035:Lgals9 UTSW 11 78963476 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTGCAACACCATGTCACAGTGTC -3'
(R):5'- AGCCTCAGAAACCTGGTGGTCTTC -3'

Sequencing Primer
(F):5'- CCATGTCACAGTGTCAAGTATGTC -3'
(R):5'- TCTACGAGGGACCCTAAGTTCTG -3'
Posted On2014-02-18