Incidental Mutation 'R1313:C1qtnf12'
ID157991
Institutional Source Beutler Lab
Gene Symbol C1qtnf12
Ensembl Gene ENSMUSG00000023571
Gene NameC1q and tumor necrosis factor related 12
Synonymsalipolin, C1qdc2, Fam132a, 1110035L05Rik
MMRRC Submission 039379-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1313 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location155962318-155966629 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 155965874 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 223 (E223K)
Ref Sequence ENSEMBL: ENSMUSP00000024338 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024338]
Predicted Effect probably damaging
Transcript: ENSMUST00000024338
AA Change: E223K

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000024338
Gene: ENSMUSG00000023571
AA Change: E223K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 94 118 N/A INTRINSIC
Blast:TNF 168 305 1e-17 BLAST
SCOP:d1gr3a_ 192 306 2e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127222
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149558
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.1%
  • 10x: 91.4%
  • 20x: 77.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A G 11: 78,265,672 T226A probably benign Het
Ankle1 A G 8: 71,407,213 E145G possibly damaging Het
Cep250 C T 2: 155,972,079 A589V probably damaging Het
Clhc1 A G 11: 29,571,678 I404V probably benign Het
Ddi1 T C 9: 6,265,769 E200G probably damaging Het
Dmxl1 T C 18: 49,878,483 S1236P probably damaging Het
Gatb A G 3: 85,653,826 I550V probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hnrnpul1 G T 7: 25,722,916 probably benign Het
Ints1 T C 5: 139,762,906 T1049A probably benign Het
Lilr4b C T 10: 51,480,736 T6I probably benign Het
Mocs1 A T 17: 49,454,269 T464S probably benign Het
Myo15b T C 11: 115,885,129 S816P probably damaging Het
Ogfr T C 2: 180,594,630 L336P probably benign Het
Olfr473 A T 7: 107,933,768 M83L probably benign Het
Psapl1 C A 5: 36,205,266 Q401K probably benign Het
Sh3rf3 C A 10: 59,071,999 Q450K possibly damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Stat1 C T 1: 52,156,006 T720I probably damaging Het
Other mutations in C1qtnf12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01796:C1qtnf12 APN 4 155966429 missense possibly damaging 0.93
IGL01832:C1qtnf12 APN 4 155965866 missense probably damaging 1.00
IGL02015:C1qtnf12 APN 4 155962744 unclassified probably benign
IGL03053:C1qtnf12 APN 4 155966464 missense probably damaging 0.99
R1313:C1qtnf12 UTSW 4 155965874 missense probably damaging 0.96
R1315:C1qtnf12 UTSW 4 155965874 missense probably damaging 0.96
R1316:C1qtnf12 UTSW 4 155965874 missense probably damaging 0.96
R1412:C1qtnf12 UTSW 4 155962733 missense probably benign
R1487:C1qtnf12 UTSW 4 155965874 missense probably damaging 0.96
R1828:C1qtnf12 UTSW 4 155965703 critical splice donor site probably null
R2146:C1qtnf12 UTSW 4 155966465 missense probably benign 0.01
R2147:C1qtnf12 UTSW 4 155966465 missense probably benign 0.01
R2148:C1qtnf12 UTSW 4 155966465 missense probably benign 0.01
R2150:C1qtnf12 UTSW 4 155966465 missense probably benign 0.01
R3786:C1qtnf12 UTSW 4 155965899 missense probably damaging 1.00
R6859:C1qtnf12 UTSW 4 155965613 missense probably damaging 1.00
R7252:C1qtnf12 UTSW 4 155962615 missense unknown
Z1177:C1qtnf12 UTSW 4 155965649 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAGTCACCTCCTAATTTCCACAG -3'
(R):5'- TTGCTCTCCAGACCTGATACAGCC -3'

Sequencing Primer
(F):5'- TCCTTGGGCCGATTCACAG -3'
(R):5'- TGATACAGCCTCCAGGGAC -3'
Posted On2014-02-18