Incidental Mutation 'R1294:Vmn1r25'
ID158016
Institutional Source Beutler Lab
Gene Symbol Vmn1r25
Ensembl Gene ENSMUSG00000115668
Gene Namevomeronasal 1 receptor 25
SynonymsV1rc8
MMRRC Submission 039360-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R1294 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location57978299-57980810 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 57978479 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 275 (I275T)
Ref Sequence ENSEMBL: ENSMUSP00000154074 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000176572] [ENSMUST00000228585]
Predicted Effect possibly damaging
Transcript: ENSMUST00000176572
AA Change: I275T

PolyPhen 2 Score 0.554 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000135860
Gene: ENSMUSG00000115668
AA Change: I275T

DomainStartEndE-ValueType
Pfam:V1R 29 293 5.4e-52 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000228585
AA Change: I275T

PolyPhen 2 Score 0.554 (Sensitivity: 0.88; Specificity: 0.91)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.4%
Validation Efficiency 97% (33/34)
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010005H15Rik T A 16: 36,257,252 D58E probably damaging Het
C2cd2 A G 16: 97,922,269 L16P probably damaging Het
Cfap57 A T 4: 118,606,534 probably null Het
Cnn2 A G 10: 79,993,525 D163G probably damaging Het
Csmd1 T C 8: 16,698,036 D233G probably damaging Het
Dhh T C 15: 98,894,383 Q248R probably benign Het
Elavl2 G A 4: 91,311,589 A19V probably benign Het
Fxr1 T A 3: 34,047,052 M169K probably benign Het
Ghr A G 15: 3,388,646 probably null Het
Gm5334 T C 7: 68,619,114 S94P probably damaging Het
Hrasls5 A G 19: 7,614,650 probably benign Het
Klk1b3 C A 7: 44,200,296 S35Y probably damaging Het
Lama5 T C 2: 180,190,921 N1646S probably benign Het
Lap3 T C 5: 45,498,521 V156A probably benign Het
Pcbp3 A G 10: 76,763,321 I327T probably damaging Het
Polr1a A T 6: 71,912,902 N35I probably damaging Het
Rab3c T C 13: 110,260,565 T56A possibly damaging Het
Rapsn A T 2: 91,036,775 K141* probably null Het
Rxrg G T 1: 167,613,901 A83S probably benign Het
Serpinc1 T C 1: 160,989,641 S102P probably damaging Het
Setd2 A G 9: 110,549,507 N797D probably benign Het
Skiv2l T C 17: 34,841,064 probably null Het
Slc24a1 A T 9: 64,936,013 V619E unknown Het
Slc25a20 A G 9: 108,677,639 M128V probably benign Het
Spam1 A G 6: 24,796,907 I286V probably benign Het
Tbc1d22a T A 15: 86,496,826 F479Y probably damaging Het
Tdrd1 A G 19: 56,848,776 probably null Het
Trim58 T A 11: 58,643,127 I169N probably benign Het
Zfp27 T A 7: 29,896,312 Y76F possibly damaging Het
Other mutations in Vmn1r25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01867:Vmn1r25 APN 6 57979211 missense probably damaging 0.99
R0299:Vmn1r25 UTSW 6 57978509 missense probably damaging 1.00
R0401:Vmn1r25 UTSW 6 57978711 missense probably benign 0.01
R0499:Vmn1r25 UTSW 6 57978509 missense probably damaging 1.00
R1562:Vmn1r25 UTSW 6 57978801 missense probably benign 0.03
R1661:Vmn1r25 UTSW 6 57978461 missense probably damaging 1.00
R1665:Vmn1r25 UTSW 6 57978461 missense probably damaging 1.00
R1879:Vmn1r25 UTSW 6 57978927 missense possibly damaging 0.50
R2221:Vmn1r25 UTSW 6 57979238 missense probably damaging 1.00
R2223:Vmn1r25 UTSW 6 57979238 missense probably damaging 1.00
R2374:Vmn1r25 UTSW 6 57978558 missense probably benign 0.10
R4073:Vmn1r25 UTSW 6 57978587 missense possibly damaging 0.94
R4398:Vmn1r25 UTSW 6 57978827 missense probably damaging 1.00
R4590:Vmn1r25 UTSW 6 57978495 missense probably benign 0.02
R4779:Vmn1r25 UTSW 6 57979026 missense probably damaging 0.98
R5397:Vmn1r25 UTSW 6 57979075 nonsense probably null
R6113:Vmn1r25 UTSW 6 57978572 missense probably benign 0.00
R6858:Vmn1r25 UTSW 6 57979011 missense probably benign 0.22
R7407:Vmn1r25 UTSW 6 57979059 missense possibly damaging 0.76
R7748:Vmn1r25 UTSW 6 57978564 missense probably damaging 1.00
R8001:Vmn1r25 UTSW 6 57979080 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGAAGAATCTCACTTTGCCCCTTGAC -3'
(R):5'- AGCATCTTCATAGCATCAGGCACC -3'

Sequencing Primer
(F):5'- tcatcagacacaccagaagag -3'
(R):5'- CATCAGGCACCTGAGAGTG -3'
Posted On2014-02-18