Incidental Mutation 'R1294:Slc25a20'
ID158023
Institutional Source Beutler Lab
Gene Symbol Slc25a20
Ensembl Gene ENSMUSG00000032602
Gene Namesolute carrier family 25 (mitochondrial carnitine/acylcarnitine translocase), member 20
Synonyms1110007P09Rik, Cact, mCAC
MMRRC Submission 039360-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1294 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location108662088-108684641 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108677639 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 128 (M128V)
Ref Sequence ENSEMBL: ENSMUSP00000035222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035222]
Predicted Effect probably benign
Transcript: ENSMUST00000035222
AA Change: M128V

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000035222
Gene: ENSMUSG00000032602
AA Change: M128V

DomainStartEndE-ValueType
Pfam:Mito_carr 6 104 4.9e-25 PFAM
Pfam:Mito_carr 106 201 5.6e-27 PFAM
Pfam:Mito_carr 205 297 7.4e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195260
Meta Mutation Damage Score 0.1620 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.4%
Validation Efficiency 97% (33/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is one of several closely related mitochondrial-membrane carrier proteins that shuttle substrates between cytosol and the intramitochondrial matrix space. This protein mediates the transport of acylcarnitines into mitochondrial matrix for their oxidation by the mitochondrial fatty acid-oxidation pathway. Mutations in this gene are associated with carnitine-acylcarnitine translocase deficiency, which can cause a variety of pathological conditions such as hypoglycemia, cardiac arrest, hepatomegaly, hepatic dysfunction and muscle weakness, and is usually lethal in new born and infants. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010005H15Rik T A 16: 36,257,252 D58E probably damaging Het
C2cd2 A G 16: 97,922,269 L16P probably damaging Het
Cfap57 A T 4: 118,606,534 probably null Het
Cnn2 A G 10: 79,993,525 D163G probably damaging Het
Csmd1 T C 8: 16,698,036 D233G probably damaging Het
Dhh T C 15: 98,894,383 Q248R probably benign Het
Elavl2 G A 4: 91,311,589 A19V probably benign Het
Fxr1 T A 3: 34,047,052 M169K probably benign Het
Ghr A G 15: 3,388,646 probably null Het
Gm5334 T C 7: 68,619,114 S94P probably damaging Het
Hrasls5 A G 19: 7,614,650 probably benign Het
Klk1b3 C A 7: 44,200,296 S35Y probably damaging Het
Lama5 T C 2: 180,190,921 N1646S probably benign Het
Lap3 T C 5: 45,498,521 V156A probably benign Het
Pcbp3 A G 10: 76,763,321 I327T probably damaging Het
Polr1a A T 6: 71,912,902 N35I probably damaging Het
Rab3c T C 13: 110,260,565 T56A possibly damaging Het
Rapsn A T 2: 91,036,775 K141* probably null Het
Rxrg G T 1: 167,613,901 A83S probably benign Het
Serpinc1 T C 1: 160,989,641 S102P probably damaging Het
Setd2 A G 9: 110,549,507 N797D probably benign Het
Skiv2l T C 17: 34,841,064 probably null Het
Slc24a1 A T 9: 64,936,013 V619E unknown Het
Spam1 A G 6: 24,796,907 I286V probably benign Het
Tbc1d22a T A 15: 86,496,826 F479Y probably damaging Het
Tdrd1 A G 19: 56,848,776 probably null Het
Trim58 T A 11: 58,643,127 I169N probably benign Het
Vmn1r25 A G 6: 57,978,479 I275T possibly damaging Het
Zfp27 T A 7: 29,896,312 Y76F possibly damaging Het
Other mutations in Slc25a20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Slc25a20 APN 9 108681999 missense possibly damaging 0.86
IGL02496:Slc25a20 APN 9 108682400 missense probably damaging 1.00
R0882:Slc25a20 UTSW 9 108681990 missense possibly damaging 0.52
R1881:Slc25a20 UTSW 9 108680209 splice site probably null
R4936:Slc25a20 UTSW 9 108681992 missense probably damaging 1.00
R7298:Slc25a20 UTSW 9 108662144 start gained probably benign
R7347:Slc25a20 UTSW 9 108682458 critical splice donor site probably null
R7400:Slc25a20 UTSW 9 108681973 missense possibly damaging 0.78
R7631:Slc25a20 UTSW 9 108662292 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTTCTCAGGGATGAGGGGACTTCAA -3'
(R):5'- AGGCATGGCAGAACATACTCATGAC -3'

Sequencing Primer
(F):5'- atctgcctgcctttgcc -3'
(R):5'- tgacccaaaacaacaaaaccc -3'
Posted On2014-02-18