Incidental Mutation 'R1294:Rab3c'
ID 158028
Institutional Source Beutler Lab
Gene Symbol Rab3c
Ensembl Gene ENSMUSG00000021700
Gene Name RAB3C, member RAS oncogene family
Synonyms
MMRRC Submission 039360-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1294 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 110054187-110280996 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 110260565 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 56 (T56A)
Ref Sequence ENSEMBL: ENSMUSP00000132945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167824] [ENSMUST00000223922] [ENSMUST00000224180]
AlphaFold P62823
Predicted Effect possibly damaging
Transcript: ENSMUST00000167824
AA Change: T56A

PolyPhen 2 Score 0.718 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000132945
Gene: ENSMUSG00000021700
AA Change: T56A

DomainStartEndE-ValueType
RAB 31 194 1.35e-93 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000223922
AA Change: T54A

PolyPhen 2 Score 0.424 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000224180
AA Change: T56A

PolyPhen 2 Score 0.641 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224287
Meta Mutation Damage Score 0.1074 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.4%
Validation Efficiency 97% (33/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the RAS oncogene family and encodes a small GTPase. Other similar small GTPases are known to be involved in vesicle trafficking, and the encoded protein was shown to play a role in recycling phagocytosed MHC class 1 complexes to the cell surface. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010005H15Rik T A 16: 36,257,252 D58E probably damaging Het
C2cd2 A G 16: 97,922,269 L16P probably damaging Het
Cfap57 A T 4: 118,606,534 probably null Het
Cnn2 A G 10: 79,993,525 D163G probably damaging Het
Csmd1 T C 8: 16,698,036 D233G probably damaging Het
Dhh T C 15: 98,894,383 Q248R probably benign Het
Elavl2 G A 4: 91,311,589 A19V probably benign Het
Fxr1 T A 3: 34,047,052 M169K probably benign Het
Ghr A G 15: 3,388,646 probably null Het
Gm5334 T C 7: 68,619,114 S94P probably damaging Het
Hrasls5 A G 19: 7,614,650 probably benign Het
Klk1b3 C A 7: 44,200,296 S35Y probably damaging Het
Lama5 T C 2: 180,190,921 N1646S probably benign Het
Lap3 T C 5: 45,498,521 V156A probably benign Het
Pcbp3 A G 10: 76,763,321 I327T probably damaging Het
Polr1a A T 6: 71,912,902 N35I probably damaging Het
Rapsn A T 2: 91,036,775 K141* probably null Het
Rxrg G T 1: 167,613,901 A83S probably benign Het
Serpinc1 T C 1: 160,989,641 S102P probably damaging Het
Setd2 A G 9: 110,549,507 N797D probably benign Het
Skiv2l T C 17: 34,841,064 probably null Het
Slc24a1 A T 9: 64,936,013 V619E unknown Het
Slc25a20 A G 9: 108,677,639 M128V probably benign Het
Spam1 A G 6: 24,796,907 I286V probably benign Het
Tbc1d22a T A 15: 86,496,826 F479Y probably damaging Het
Tdrd1 A G 19: 56,848,776 probably null Het
Trim58 T A 11: 58,643,127 I169N probably benign Het
Vmn1r25 A G 6: 57,978,479 I275T possibly damaging Het
Zfp27 T A 7: 29,896,312 Y76F possibly damaging Het
Other mutations in Rab3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1346:Rab3c UTSW 13 110260586 missense probably damaging 1.00
R1819:Rab3c UTSW 13 110084135 missense possibly damaging 0.52
R1903:Rab3c UTSW 13 110084210 missense probably damaging 1.00
R2059:Rab3c UTSW 13 110260516 missense probably damaging 1.00
R4018:Rab3c UTSW 13 110084194 missense probably damaging 1.00
R4707:Rab3c UTSW 13 110061900 missense probably benign 0.00
R4784:Rab3c UTSW 13 110061900 missense probably benign 0.00
R4785:Rab3c UTSW 13 110061900 missense probably benign 0.00
R5305:Rab3c UTSW 13 110181077 missense probably damaging 1.00
R5358:Rab3c UTSW 13 110061963 missense possibly damaging 0.77
R8136:Rab3c UTSW 13 110181020 nonsense probably null
R8739:Rab3c UTSW 13 110260601 missense probably damaging 0.98
Z1177:Rab3c UTSW 13 110260486 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATCAAGGAAGAGCCGCACTCTC -3'
(R):5'- CACAGATGGCCTCTGCACAAGATG -3'

Sequencing Primer
(F):5'- CAAACACAGGAGCTTGGATTTC -3'
(R):5'- GCCAGGTTTGGTCAGAAAGA -3'
Posted On 2014-02-18