Incidental Mutation 'R1294:C2cd2'
ID158032
Institutional Source Beutler Lab
Gene Symbol C2cd2
Ensembl Gene ENSMUSG00000045975
Gene NameC2 calcium-dependent domain containing 2
SynonymsORF25, 5830404H04Rik
MMRRC Submission 039360-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1294 (G1)
Quality Score147
Status Validated
Chromosome16
Chromosomal Location97855209-97962598 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 97922269 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 16 (L16P)
Ref Sequence ENSEMBL: ENSMUSP00000127368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170757] [ENSMUST00000232165]
Predicted Effect probably damaging
Transcript: ENSMUST00000170757
AA Change: L16P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127368
Gene: ENSMUSG00000045975
AA Change: L16P

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 106 122 N/A INTRINSIC
Pfam:C2 232 359 1.9e-6 PFAM
low complexity region 410 421 N/A INTRINSIC
low complexity region 491 517 N/A INTRINSIC
low complexity region 605 616 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231953
Predicted Effect probably benign
Transcript: ENSMUST00000232165
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232572
Meta Mutation Damage Score 0.7178 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.4%
Validation Efficiency 97% (33/34)
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010005H15Rik T A 16: 36,257,252 D58E probably damaging Het
Cfap57 A T 4: 118,606,534 probably null Het
Cnn2 A G 10: 79,993,525 D163G probably damaging Het
Csmd1 T C 8: 16,698,036 D233G probably damaging Het
Dhh T C 15: 98,894,383 Q248R probably benign Het
Elavl2 G A 4: 91,311,589 A19V probably benign Het
Fxr1 T A 3: 34,047,052 M169K probably benign Het
Ghr A G 15: 3,388,646 probably null Het
Gm5334 T C 7: 68,619,114 S94P probably damaging Het
Hrasls5 A G 19: 7,614,650 probably benign Het
Klk1b3 C A 7: 44,200,296 S35Y probably damaging Het
Lama5 T C 2: 180,190,921 N1646S probably benign Het
Lap3 T C 5: 45,498,521 V156A probably benign Het
Pcbp3 A G 10: 76,763,321 I327T probably damaging Het
Polr1a A T 6: 71,912,902 N35I probably damaging Het
Rab3c T C 13: 110,260,565 T56A possibly damaging Het
Rapsn A T 2: 91,036,775 K141* probably null Het
Rxrg G T 1: 167,613,901 A83S probably benign Het
Serpinc1 T C 1: 160,989,641 S102P probably damaging Het
Setd2 A G 9: 110,549,507 N797D probably benign Het
Skiv2l T C 17: 34,841,064 probably null Het
Slc24a1 A T 9: 64,936,013 V619E unknown Het
Slc25a20 A G 9: 108,677,639 M128V probably benign Het
Spam1 A G 6: 24,796,907 I286V probably benign Het
Tbc1d22a T A 15: 86,496,826 F479Y probably damaging Het
Tdrd1 A G 19: 56,848,776 probably null Het
Trim58 T A 11: 58,643,127 I169N probably benign Het
Vmn1r25 A G 6: 57,978,479 I275T possibly damaging Het
Zfp27 T A 7: 29,896,312 Y76F possibly damaging Het
Other mutations in C2cd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:C2cd2 APN 16 97870220 missense probably damaging 1.00
IGL01633:C2cd2 APN 16 97875123 splice site probably benign
IGL01731:C2cd2 APN 16 97870172 missense probably damaging 1.00
IGL02071:C2cd2 APN 16 97870232 missense probably damaging 1.00
IGL02086:C2cd2 APN 16 97890008 splice site probably benign
IGL02502:C2cd2 APN 16 97876390 missense possibly damaging 0.85
IGL02933:C2cd2 APN 16 97892201 missense probably benign 0.22
IGL03005:C2cd2 APN 16 97859432 missense probably damaging 0.99
IGL03493:C2cd2 APN 16 97881661 missense probably damaging 0.97
H8562:C2cd2 UTSW 16 97879640 missense possibly damaging 0.91
H8786:C2cd2 UTSW 16 97879640 missense possibly damaging 0.91
R0480:C2cd2 UTSW 16 97877148 missense probably benign 0.45
R0483:C2cd2 UTSW 16 97859588 splice site probably benign
R0541:C2cd2 UTSW 16 97922296 missense possibly damaging 0.66
R1986:C2cd2 UTSW 16 97870271 missense probably damaging 1.00
R2518:C2cd2 UTSW 16 97922086 missense probably benign 0.01
R5468:C2cd2 UTSW 16 97868591 unclassified probably null
R5507:C2cd2 UTSW 16 97881620 missense probably benign 0.01
R5979:C2cd2 UTSW 16 97875218 missense probably benign 0.01
R6466:C2cd2 UTSW 16 97879622 missense probably benign
R7264:C2cd2 UTSW 16 97876219 critical splice donor site probably null
R7372:C2cd2 UTSW 16 97875380 missense
R8003:C2cd2 UTSW 16 97886086 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACTTCAAAGAACGCCTTTCCTCGG -3'
(R):5'- GGAAGAAGAGCCTTTGCCTTGCAC -3'

Sequencing Primer
(F):5'- TCATAGTTCAGGGCGGTCAC -3'
(R):5'- GGAGCAGCTTCCTCTGTC -3'
Posted On2014-02-18