Mutagenetix > Incidental Mutation

Incidental Mutation 'R1295:Sele'

158040

Institutional Source

Beutler Lab

Gene Symbol

Sele

Ensembl Gene

ENSMUSG00000026582

Gene Name

selectin, endothelial cell

Synonyms

CD62E, E-selectin, Elam

MMRRC Submission

039361-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.077) question?

Stock #

R1295 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

164048234-164057677 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 164050810 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 239 (S239R)

Ref Sequence

ENSEMBL: ENSMUSP00000027874 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027874]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000027874
AA Change: S239R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000027874
Gene: ENSMUSG00000026582
AA Change: S239R

Domain	Start	End	E-Value	Type
CLECT	21	146	1.45e-21	SMART
EGF	149	182	2.83e-5	SMART
CCP	187	245	1.49e-9	SMART
CCP	250	307	5.43e-12	SMART
CCP	312	370	1.82e-13	SMART
CCP	375	433	1.36e-12	SMART
CCP	438	496	6e-14	SMART
CCP	501	555	1.39e-9	SMART
transmembrane domain	565	587	N/A	INTRINSIC

Meta Mutation Damage Score

0.5224

Coding Region Coverage

1x: 98.7%
3x: 97.4%
10x: 93.1%
20x: 82.0%

Validation Efficiency

98% (81/83)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found in cytokine-stimulated endothelial cells and is thought to be responsible for the accumulation of blood leukocytes at sites of inflammation by mediating the adhesion of cells to the vascular lining. It exhibits structural features such as the presence of lectin- and EGF-like domains followed by short consensus repeat (SCR) domains that contain 6 conserved cysteine residues. These proteins are part of the selectin family of cell adhesion molecules. Adhesion molecules participate in the interaction between leukocytes and the endothelium and appear to be involved in the pathogenesis of atherosclerosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit mild defects in neutrophil infiltration during inflammatory responses. When combined with other selectin gene knockouts, more severe defects are present. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ackr2	A	G	9: 121,908,717	S53G	possibly damaging	Het
Adgrb1	T	A	15: 74,550,039	L886Q	probably damaging	Het
Adprhl1	G	A	8: 13,248,624	T102M	probably damaging	Het
Akap6	A	C	12: 52,887,029	K435Q	probably damaging	Het
Aldh7a1	T	C	18: 56,546,950		probably null	Het
Amfr	T	C	8: 93,974,804	R507G	probably benign	Het
Ap1m1	T	A	8: 72,251,875		probably null	Het
Arhgap29	A	G	3: 121,992,395	H275R	probably benign	Het
Arhgef17	C	A	7: 100,881,269	E428*	probably null	Het
Atm	A	T	9: 53,456,530	V2431E	probably damaging	Het
Atn1	G	T	6: 124,747,787	P161Q	unknown	Het
Atp13a2	T	C	4: 140,993,802	S99P	probably damaging	Het
Ccar1	C	A	10: 62,783,882		probably null	Het
Cdk18	T	C	1: 132,119,960		probably benign	Het
Cep85	A	G	4: 134,167,400	W32R	probably damaging	Het
Col5a3	A	G	9: 20,808,418	F215S	unknown	Het
Decr1	T	C	4: 15,919,207	N312S	possibly damaging	Het
Diaph3	A	T	14: 87,007,399	W178R	probably damaging	Het
Dync2h1	A	G	9: 7,075,752		probably benign	Het
Ehd3	C	A	17: 73,828,186	D352E	probably damaging	Het
Enpp6	T	G	8: 47,065,500	I221S	probably benign	Het
Fam186a	T	C	15: 99,939,789		probably benign	Het
Gm5435	G	T	12: 82,495,784		noncoding transcript	Het
Gm6990	T	A	19: 56,755,334		noncoding transcript	Het
Gpr22	A	C	12: 31,709,514	I203S	probably benign	Het
Gpr61	A	G	3: 108,150,481	V288A	possibly damaging	Het
Grik3	G	A	4: 125,704,564		probably benign	Het
Gstcd	T	C	3: 133,005,628	N431D	probably damaging	Het
Haao	T	A	17: 83,838,838	Q69L	probably benign	Het
Hist1h1b	T	C	13: 21,779,999	S186G	probably benign	Het
Ift140	G	T	17: 25,088,933		probably null	Het
Ikbke	A	G	1: 131,270,226	V381A	probably benign	Het
Ing1	A	C	8: 11,561,501	I38L	probably benign	Het
Ing1	T	A	8: 11,561,502	I38N	probably damaging	Het
Itga4	A	G	2: 79,322,689	M907V	possibly damaging	Het
Kcnk12	C	T	17: 87,746,373	G287D	probably damaging	Het
Kmt2e	A	C	5: 23,502,404	H1655P	probably damaging	Het
Mbtd1	A	G	11: 93,910,359	Y122C	probably damaging	Het
Mslnl	T	C	17: 25,743,240	L204P	probably damaging	Het
Muc6	T	C	7: 141,651,879	E112G	probably benign	Het
Nav3	T	A	10: 109,692,102	D2240V	probably damaging	Het
Ndufaf3	T	C	9: 108,566,693	T9A	probably damaging	Het
Numb	C	A	12: 83,796,161		probably benign	Het
Prodh2	T	C	7: 30,494,089	V79A	probably damaging	Het
Psmb2	A	G	4: 126,687,032	Y73C	probably damaging	Het
Rmnd5a	G	A	6: 71,398,455	L80F	probably benign	Het
Rnf19a	G	T	15: 36,244,101	Y604*	probably null	Het
Ros1	T	A	10: 52,087,932	E1744V	possibly damaging	Het
Rpusd2	T	C	2: 119,036,927	F219L	probably benign	Het
Sall2	T	C	14: 52,313,725	N671S	probably damaging	Het
Serpina3b	T	C	12: 104,130,879	F140L	probably damaging	Het
Stxbp1	A	T	2: 32,794,636	S594T	probably benign	Het
Sufu	G	A	19: 46,454,720		probably benign	Het
Tbx2	A	G	11: 85,834,766	E181G	probably damaging	Het
Thumpd2	A	G	17: 81,055,888	V50A	probably damaging	Het
Tmem56	A	G	3: 121,207,291	V231A	probably benign	Het
Ttn	C	A	2: 76,743,245	R17441L	probably damaging	Het
Usp34	A	G	11: 23,384,477	Y1157C	probably damaging	Het
Vmn1r9	T	C	6: 57,071,537	V199A	probably damaging	Het
Vmn2r6	A	G	3: 64,538,273	F677S	probably damaging	Het
Vmn2r84	C	T	10: 130,389,139	A501T	probably benign	Het
Wapl	C	T	14: 34,724,769	P605S	probably damaging	Het
Zfp598	A	G	17: 24,679,649	N474S	probably benign	Het
Zfyve26	A	G	12: 79,274,920	L975P	probably damaging	Het
Zp3r	C	T	1: 130,591,444	G255D	probably damaging	Het

Other mutations in Sele

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00233:Sele	APN	1	164051834	missense	probably damaging	1.00
IGL02097:Sele	APN	1	164053093	missense	probably benign	0.02
IGL02243:Sele	APN	1	164052968	missense	probably benign	0.01
IGL02688:Sele	APN	1	164050130	missense	probably damaging	1.00
IGL03022:Sele	APN	1	164054679	missense	probably benign	0.01
R0433:Sele	UTSW	1	164049244	missense	possibly damaging	0.74
R0487:Sele	UTSW	1	164053615	nonsense	probably null
R0678:Sele	UTSW	1	164054729	critical splice donor site	probably null
R1296:Sele	UTSW	1	164050810	missense	probably damaging	1.00
R1532:Sele	UTSW	1	164053851	missense	probably benign	0.29
R1730:Sele	UTSW	1	164054623	missense	probably benign
R2102:Sele	UTSW	1	164053826	missense	probably damaging	1.00
R2384:Sele	UTSW	1	164050775	missense	probably benign	0.00
R3001:Sele	UTSW	1	164053571	missense	probably damaging	1.00
R3002:Sele	UTSW	1	164053571	missense	probably damaging	1.00
R5851:Sele	UTSW	1	164049574	missense	probably benign	0.06
R6164:Sele	UTSW	1	164051817	splice site	probably null
R6239:Sele	UTSW	1	164050808	missense	probably damaging	0.98
R6406:Sele	UTSW	1	164050743	missense	probably damaging	1.00
R6411:Sele	UTSW	1	164049415	missense	probably benign	0.03
R6731:Sele	UTSW	1	164053673	missense	probably damaging	1.00
R6851:Sele	UTSW	1	164053952	missense	probably damaging	1.00
R7291:Sele	UTSW	1	164053868	missense	possibly damaging	0.89
R7328:Sele	UTSW	1	164049275	missense	probably benign	0.23
R7366:Sele	UTSW	1	164048719	missense	probably benign	0.00
R7393:Sele	UTSW	1	164053923	missense	probably benign	0.05
R7431:Sele	UTSW	1	164051620	missense	probably damaging	0.99
R7603:Sele	UTSW	1	164049515	missense	probably damaging	1.00
R7803:Sele	UTSW	1	164050694	missense	possibly damaging	0.88
R7807:Sele	UTSW	1	164053893	missense	probably benign	0.05
R8323:Sele	UTSW	1	164051638	missense	possibly damaging	0.59
R9018:Sele	UTSW	1	164053679	missense	probably damaging	1.00
R9310:Sele	UTSW	1	164049406	missense	probably benign	0.04
R9630:Sele	UTSW	1	164051954	missense	probably damaging	0.99
X0005:Sele	UTSW	1	164049343	missense	probably damaging	1.00
X0021:Sele	UTSW	1	164053611	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- AGGAACACCCTGACTATGGAAGCC -3'
(R):5'- TTGCCGTGCAAAGAGAAGCTCC -3'

Sequencing Primer
(F):5'- TATGGAAGCCTGAACTGCTC -3'
(R):5'- CTCAACAAGGTCCTATTGCATGG -3'

Posted On

2014-02-18