Mutagenetix > Incidental Mutations

Incidental Mutation 'R1295:Stxbp1'

158041

Institutional Source

Beutler Lab

Gene Symbol

Stxbp1

Ensembl Gene

ENSMUSG00000026797

Gene Name

syntaxin binding protein 1

Synonyms

Rb-sec1, Munc18-1, Munc-18a, Sxtbp1, Unc18h, N-sec1, nsec1

MMRRC Submission

039361-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.622) question?

Stock #

R1295 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

32787602-32847245 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 32794636 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 594 (S594T)

Ref Sequence

ENSEMBL: ENSMUSP00000089051 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000050000] [ENSMUST00000077458]

Predicted Effect

probably benign
Transcript: ENSMUST00000050000

SMART Domains

Protein: ENSMUSP00000052440
Gene: ENSMUSG00000026797

Domain	Start	End	E-Value	Type
Pfam:Sec1	28	582	9.8e-152	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000077458
AA Change: S594T

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000089051
Gene: ENSMUSG00000026797
AA Change: S594T

Domain	Start	End	E-Value	Type
Pfam:Sec1	29	581	2.8e-110	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000113222

SMART Domains

Protein: ENSMUSP00000108848
Gene: ENSMUSG00000026797

Domain	Start	End	E-Value	Type
Pfam:Sec1	1	419	1.7e-106	PFAM

Meta Mutation Damage Score

0.1574

Coding Region Coverage

1x: 98.7%
3x: 97.4%
10x: 93.1%
20x: 82.0%

Validation Efficiency

98% (81/83)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a syntaxin-binding protein. The encoded protein appears to play a role in release of neurotransmitters via regulation of syntaxin, a transmembrane attachment protein receptor. Mutations in this gene have been associated with infantile epileptic encephalopathy-4. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit total loss of neurotransmitter secretion from synaptic vesicles throughout development and massive neuron apoptosis after initial synaptogenesis, leading to widespread neurodegeneration and complete neonatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ackr2	A	G	9: 121,908,717	S53G	possibly damaging	Het
Adgrb1	T	A	15: 74,550,039	L886Q	probably damaging	Het
Adprhl1	G	A	8: 13,248,624	T102M	probably damaging	Het
Akap6	A	C	12: 52,887,029	K435Q	probably damaging	Het
Aldh7a1	T	C	18: 56,546,950		probably null	Het
Amfr	T	C	8: 93,974,804	R507G	probably benign	Het
Ap1m1	T	A	8: 72,251,875		probably null	Het
Arhgap29	A	G	3: 121,992,395	H275R	probably benign	Het
Arhgef17	C	A	7: 100,881,269	E428*	probably null	Het
Atm	A	T	9: 53,456,530	V2431E	probably damaging	Het
Atn1	G	T	6: 124,747,787	P161Q	unknown	Het
Atp13a2	T	C	4: 140,993,802	S99P	probably damaging	Het
Ccar1	C	A	10: 62,783,882		probably null	Het
Cdk18	T	C	1: 132,119,960		probably benign	Het
Cep85	A	G	4: 134,167,400	W32R	probably damaging	Het
Col5a3	A	G	9: 20,808,418	F215S	unknown	Het
Decr1	T	C	4: 15,919,207	N312S	possibly damaging	Het
Diaph3	A	T	14: 87,007,399	W178R	probably damaging	Het
Dync2h1	A	G	9: 7,075,752		probably benign	Het
Ehd3	C	A	17: 73,828,186	D352E	probably damaging	Het
Enpp6	T	G	8: 47,065,500	I221S	probably benign	Het
Fam186a	T	C	15: 99,939,789		probably benign	Het
Gm5435	G	T	12: 82,495,784		noncoding transcript	Het
Gm6990	T	A	19: 56,755,334		noncoding transcript	Het
Gpr22	A	C	12: 31,709,514	I203S	probably benign	Het
Gpr61	A	G	3: 108,150,481	V288A	possibly damaging	Het
Grik3	G	A	4: 125,704,564		probably benign	Het
Gstcd	T	C	3: 133,005,628	N431D	probably damaging	Het
Haao	T	A	17: 83,838,838	Q69L	probably benign	Het
Hist1h1b	T	C	13: 21,779,999	S186G	probably benign	Het
Ift140	G	T	17: 25,088,933		probably null	Het
Ikbke	A	G	1: 131,270,226	V381A	probably benign	Het
Ing1	A	C	8: 11,561,501	I38L	probably benign	Het
Ing1	T	A	8: 11,561,502	I38N	probably damaging	Het
Itga4	A	G	2: 79,322,689	M907V	possibly damaging	Het
Kcnk12	C	T	17: 87,746,373	G287D	probably damaging	Het
Kmt2e	A	C	5: 23,502,404	H1655P	probably damaging	Het
Mbtd1	A	G	11: 93,910,359	Y122C	probably damaging	Het
Mslnl	T	C	17: 25,743,240	L204P	probably damaging	Het
Muc6	T	C	7: 141,651,879	E112G	probably benign	Het
Nav3	T	A	10: 109,692,102	D2240V	probably damaging	Het
Ndufaf3	T	C	9: 108,566,693	T9A	probably damaging	Het
Numb	C	A	12: 83,796,161		probably benign	Het
Prodh2	T	C	7: 30,494,089	V79A	probably damaging	Het
Psmb2	A	G	4: 126,687,032	Y73C	probably damaging	Het
Rmnd5a	G	A	6: 71,398,455	L80F	probably benign	Het
Rnf19a	G	T	15: 36,244,101	Y604*	probably null	Het
Ros1	T	A	10: 52,087,932	E1744V	possibly damaging	Het
Rpusd2	T	C	2: 119,036,927	F219L	probably benign	Het
Sall2	T	C	14: 52,313,725	N671S	probably damaging	Het
Sele	T	A	1: 164,050,810	S239R	probably damaging	Het
Serpina3b	T	C	12: 104,130,879	F140L	probably damaging	Het
Sufu	G	A	19: 46,454,720		probably benign	Het
Tbx2	A	G	11: 85,834,766	E181G	probably damaging	Het
Thumpd2	A	G	17: 81,055,888	V50A	probably damaging	Het
Tmem56	A	G	3: 121,207,291	V231A	probably benign	Het
Ttn	C	A	2: 76,743,245	R17441L	probably damaging	Het
Usp34	A	G	11: 23,384,477	Y1157C	probably damaging	Het
Vmn1r9	T	C	6: 57,071,537	V199A	probably damaging	Het
Vmn2r6	A	G	3: 64,538,273	F677S	probably damaging	Het
Vmn2r84	C	T	10: 130,389,139	A501T	probably benign	Het
Wapl	C	T	14: 34,724,769	P605S	probably damaging	Het
Zfp598	A	G	17: 24,679,649	N474S	probably benign	Het
Zfyve26	A	G	12: 79,274,920	L975P	probably damaging	Het
Zp3r	C	T	1: 130,591,444	G255D	probably damaging	Het

Other mutations in Stxbp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01989:Stxbp1	APN	2	32812064	missense	probably benign	0.00
IGL02743:Stxbp1	APN	2	32819901	missense	probably damaging	0.98
volume	UTSW	2	32801893	missense	probably damaging	0.99
volume2	UTSW	2	32801883	missense	possibly damaging	0.95
P0021:Stxbp1	UTSW	2	32823538	missense	probably damaging	0.96
R0217:Stxbp1	UTSW	2	32801870	missense	possibly damaging	0.69
R0269:Stxbp1	UTSW	2	32802783	missense	probably damaging	1.00
R0285:Stxbp1	UTSW	2	32823542	missense	probably benign	0.00
R0335:Stxbp1	UTSW	2	32802905	splice site	probably benign
R0565:Stxbp1	UTSW	2	32819848	missense	probably benign	0.07
R0617:Stxbp1	UTSW	2	32802783	missense	probably damaging	1.00
R0690:Stxbp1	UTSW	2	32800695	splice site	probably benign
R1022:Stxbp1	UTSW	2	32814967	unclassified	probably null
R1024:Stxbp1	UTSW	2	32814967	unclassified	probably null
R1296:Stxbp1	UTSW	2	32794636	missense	probably benign	0.18
R1472:Stxbp1	UTSW	2	32794636	missense	probably benign	0.18
R1699:Stxbp1	UTSW	2	32800617	missense	probably damaging	0.99
R1744:Stxbp1	UTSW	2	32806719	critical splice donor site	probably null
R2004:Stxbp1	UTSW	2	32798189	missense	probably damaging	0.99
R2151:Stxbp1	UTSW	2	32802856	missense	probably damaging	1.00
R2153:Stxbp1	UTSW	2	32802856	missense	probably damaging	1.00
R2154:Stxbp1	UTSW	2	32802856	missense	probably damaging	1.00
R5170:Stxbp1	UTSW	2	32794674	missense	probably benign	0.01
R6083:Stxbp1	UTSW	2	32796018	missense	possibly damaging	0.95
R6295:Stxbp1	UTSW	2	32794609	missense	probably damaging	0.98
R6504:Stxbp1	UTSW	2	32801883	missense	possibly damaging	0.95
R6770:Stxbp1	UTSW	2	32819889	missense	probably benign	0.01
R6954:Stxbp1	UTSW	2	32801893	missense	probably damaging	0.99
R7283:Stxbp1	UTSW	2	32815014	missense	probably damaging	1.00
R7382:Stxbp1	UTSW	2	32798168	missense	probably damaging	1.00
R7541:Stxbp1	UTSW	2	32818505	missense	probably damaging	0.99
R7734:Stxbp1	UTSW	2	32801820	missense	probably benign	0.00
X0060:Stxbp1	UTSW	2	32802768	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCTACTGTCACTTGGCCTAACCC -3'
(R):5'- TTCTGAAAGCAGCCACCATCCG -3'

Sequencing Primer
(F):5'- CGCAAGCATTTTCTTGGAaaaagg -3'
(R):5'- ATGCCTGCATACGTGTGT -3'

Posted On

2014-02-18