Incidental Mutation 'R1295:Atn1'
ID158058
Institutional Source Beutler Lab
Gene Symbol Atn1
Ensembl Gene ENSMUSG00000004263
Gene Nameatrophin 1
Synonymsatrophin-1, Drpla, Atr1
MMRRC Submission 039361-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1295 (G1)
Quality Score179
Status Validated
Chromosome6
Chromosomal Location124742544-124756524 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 124747787 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 161 (P161Q)
Ref Sequence ENSEMBL: ENSMUSP00000123560 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088357] [ENSMUST00000129411] [ENSMUST00000146872]
Predicted Effect unknown
Transcript: ENSMUST00000088357
AA Change: P161Q
SMART Domains Protein: ENSMUSP00000085695
Gene: ENSMUSG00000004263
AA Change: P161Q

DomainStartEndE-ValueType
Pfam:Atrophin-1 1 191 7.9e-30 PFAM
low complexity region 209 218 N/A INTRINSIC
low complexity region 231 253 N/A INTRINSIC
low complexity region 256 297 N/A INTRINSIC
low complexity region 301 317 N/A INTRINSIC
low complexity region 351 372 N/A INTRINSIC
low complexity region 378 396 N/A INTRINSIC
Pfam:Atrophin-1 405 1174 4.6e-209 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000129411
AA Change: P161Q
SMART Domains Protein: ENSMUSP00000115407
Gene: ENSMUSG00000107478
AA Change: P161Q

DomainStartEndE-ValueType
Pfam:Atrophin-1 1 164 3.8e-33 PFAM
low complexity region 209 218 N/A INTRINSIC
low complexity region 231 253 N/A INTRINSIC
low complexity region 256 297 N/A INTRINSIC
low complexity region 301 317 N/A INTRINSIC
Pfam:Atrophin-1 327 1175 1.7e-192 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133577
Predicted Effect unknown
Transcript: ENSMUST00000146872
AA Change: P161Q
SMART Domains Protein: ENSMUSP00000123560
Gene: ENSMUSG00000004263
AA Change: P161Q

DomainStartEndE-ValueType
Pfam:Atrophin-1 1 182 2.6e-36 PFAM
Meta Mutation Damage Score 0.1460 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.4%
  • 10x: 93.1%
  • 20x: 82.0%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dentatorubral pallidoluysian atrophy (DRPLA) is a rare neurodegenerative disorder characterized by cerebellar ataxia, myoclonic epilepsy, choreoathetosis, and dementia. The disorder is related to the expansion from 7-35 copies to 49-93 copies of a trinucleotide repeat (CAG/CAA) within this gene. The encoded protein includes a serine repeat and a region of alternating acidic and basic amino acids, as well as the variable glutamine repeat. Alternative splicing results in two transcripts variants that encode the same protein. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous null mice are viable and fertile, however mice expressing a truncated protein lacking the poly-Q repeat and C-terminal peptides display growth retardation, progressive male infertility with small testis and low sperm counts, and consume less food. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr2 A G 9: 121,908,717 S53G possibly damaging Het
Adgrb1 T A 15: 74,550,039 L886Q probably damaging Het
Adprhl1 G A 8: 13,248,624 T102M probably damaging Het
Akap6 A C 12: 52,887,029 K435Q probably damaging Het
Aldh7a1 T C 18: 56,546,950 probably null Het
Amfr T C 8: 93,974,804 R507G probably benign Het
Ap1m1 T A 8: 72,251,875 probably null Het
Arhgap29 A G 3: 121,992,395 H275R probably benign Het
Arhgef17 C A 7: 100,881,269 E428* probably null Het
Atm A T 9: 53,456,530 V2431E probably damaging Het
Atp13a2 T C 4: 140,993,802 S99P probably damaging Het
Ccar1 C A 10: 62,783,882 probably null Het
Cdk18 T C 1: 132,119,960 probably benign Het
Cep85 A G 4: 134,167,400 W32R probably damaging Het
Col5a3 A G 9: 20,808,418 F215S unknown Het
Decr1 T C 4: 15,919,207 N312S possibly damaging Het
Diaph3 A T 14: 87,007,399 W178R probably damaging Het
Dync2h1 A G 9: 7,075,752 probably benign Het
Ehd3 C A 17: 73,828,186 D352E probably damaging Het
Enpp6 T G 8: 47,065,500 I221S probably benign Het
Fam186a T C 15: 99,939,789 probably benign Het
Gm5435 G T 12: 82,495,784 noncoding transcript Het
Gm6990 T A 19: 56,755,334 noncoding transcript Het
Gpr22 A C 12: 31,709,514 I203S probably benign Het
Gpr61 A G 3: 108,150,481 V288A possibly damaging Het
Grik3 G A 4: 125,704,564 probably benign Het
Gstcd T C 3: 133,005,628 N431D probably damaging Het
Haao T A 17: 83,838,838 Q69L probably benign Het
Hist1h1b T C 13: 21,779,999 S186G probably benign Het
Ift140 G T 17: 25,088,933 probably null Het
Ikbke A G 1: 131,270,226 V381A probably benign Het
Ing1 A C 8: 11,561,501 I38L probably benign Het
Ing1 T A 8: 11,561,502 I38N probably damaging Het
Itga4 A G 2: 79,322,689 M907V possibly damaging Het
Kcnk12 C T 17: 87,746,373 G287D probably damaging Het
Kmt2e A C 5: 23,502,404 H1655P probably damaging Het
Mbtd1 A G 11: 93,910,359 Y122C probably damaging Het
Mslnl T C 17: 25,743,240 L204P probably damaging Het
Muc6 T C 7: 141,651,879 E112G probably benign Het
Nav3 T A 10: 109,692,102 D2240V probably damaging Het
Ndufaf3 T C 9: 108,566,693 T9A probably damaging Het
Numb C A 12: 83,796,161 probably benign Het
Prodh2 T C 7: 30,494,089 V79A probably damaging Het
Psmb2 A G 4: 126,687,032 Y73C probably damaging Het
Rmnd5a G A 6: 71,398,455 L80F probably benign Het
Rnf19a G T 15: 36,244,101 Y604* probably null Het
Ros1 T A 10: 52,087,932 E1744V possibly damaging Het
Rpusd2 T C 2: 119,036,927 F219L probably benign Het
Sall2 T C 14: 52,313,725 N671S probably damaging Het
Sele T A 1: 164,050,810 S239R probably damaging Het
Serpina3b T C 12: 104,130,879 F140L probably damaging Het
Stxbp1 A T 2: 32,794,636 S594T probably benign Het
Sufu G A 19: 46,454,720 probably benign Het
Tbx2 A G 11: 85,834,766 E181G probably damaging Het
Thumpd2 A G 17: 81,055,888 V50A probably damaging Het
Tmem56 A G 3: 121,207,291 V231A probably benign Het
Ttn C A 2: 76,743,245 R17441L probably damaging Het
Usp34 A G 11: 23,384,477 Y1157C probably damaging Het
Vmn1r9 T C 6: 57,071,537 V199A probably damaging Het
Vmn2r6 A G 3: 64,538,273 F677S probably damaging Het
Vmn2r84 C T 10: 130,389,139 A501T probably benign Het
Wapl C T 14: 34,724,769 P605S probably damaging Het
Zfp598 A G 17: 24,679,649 N474S probably benign Het
Zfyve26 A G 12: 79,274,920 L975P probably damaging Het
Zp3r C T 1: 130,591,444 G255D probably damaging Het
Other mutations in Atn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Atn1 APN 6 124749276 missense probably damaging 0.96
Janvier UTSW 6 124744956 unclassified probably benign
R0122:Atn1 UTSW 6 124743234 unclassified probably benign
R0227:Atn1 UTSW 6 124746930 unclassified probably benign
R0385:Atn1 UTSW 6 124743371 unclassified probably benign
R0394:Atn1 UTSW 6 124749733 splice site probably benign
R0834:Atn1 UTSW 6 124743225 unclassified probably benign
R1296:Atn1 UTSW 6 124747787 missense unknown
R1865:Atn1 UTSW 6 124745296 unclassified probably benign
R1992:Atn1 UTSW 6 124745328 unclassified probably benign
R2268:Atn1 UTSW 6 124746240 unclassified probably benign
R3826:Atn1 UTSW 6 124746219 unclassified probably benign
R4903:Atn1 UTSW 6 124743257 unclassified probably benign
R5601:Atn1 UTSW 6 124743228 critical splice donor site probably null
R5680:Atn1 UTSW 6 124747815 missense possibly damaging 0.92
R6167:Atn1 UTSW 6 124746737 unclassified probably benign
R6314:Atn1 UTSW 6 124747050 unclassified probably benign
R6427:Atn1 UTSW 6 124746176 unclassified probably benign
R6538:Atn1 UTSW 6 124746549 unclassified probably benign
R6606:Atn1 UTSW 6 124744956 unclassified probably benign
R7240:Atn1 UTSW 6 124747898 missense unknown
R8090:Atn1 UTSW 6 124745341 missense unknown
Z1177:Atn1 UTSW 6 124745035 missense unknown
Predicted Primers PCR Primer
(F):5'- TAGCATTCCCAGGGTAGAGCTGTG -3'
(R):5'- ACTATTAGGGAGCAGCCGAGATGTG -3'

Sequencing Primer
(F):5'- GGGTGTGTGGGAGGAGC -3'
(R):5'- ATTTTCCCTGACAGCAGGAGC -3'
Posted On2014-02-18