Mutagenetix > Incidental Mutation

Incidental Mutation 'R1295:Mbtd1'

158079

Institutional Source

Beutler Lab

Gene Symbol

Mbtd1

Ensembl Gene

ENSMUSG00000059474

Gene Name

mbt domain containing 1

Synonyms

hemp

MMRRC Submission

039361-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1295 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

93885852-93946985 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 93910359 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 122 (Y122C)

Ref Sequence

ENSEMBL: ENSMUSP00000103482 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000063645] [ENSMUST00000063718] [ENSMUST00000107850] [ENSMUST00000107852] [ENSMUST00000107853] [ENSMUST00000107854]

AlphaFold

Q6P5G3

Predicted Effect

possibly damaging
Transcript: ENSMUST00000063645
AA Change: Y122C

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000070248
Gene: ENSMUSG00000059474
AA Change: Y122C

Domain	Start	End	E-Value	Type
low complexity region	7	24	N/A	INTRINSIC
PDB:2W0T\|A	52	74	7e-6	PDB
low complexity region	75	90	N/A	INTRINSIC
low complexity region	114	130	N/A	INTRINSIC
MBT	144	248	3.11e-22	SMART
MBT	256	357	1.28e-41	SMART
MBT	361	459	1.61e-38	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000063718
AA Change: Y144C

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000065442
Gene: ENSMUSG00000059474
AA Change: Y144C

Domain	Start	End	E-Value	Type
low complexity region	29	46	N/A	INTRINSIC
PDB:2W0T\|A	74	96	7e-6	PDB
low complexity region	97	112	N/A	INTRINSIC
low complexity region	136	152	N/A	INTRINSIC
MBT	166	270	3.11e-22	SMART
MBT	278	379	1.28e-41	SMART
MBT	383	481	1.61e-38	SMART
MBT	489	585	4.11e-54	SMART
low complexity region	586	614	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000107850
AA Change: Y122C

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000103482
Gene: ENSMUSG00000059474
AA Change: Y122C

Domain	Start	End	E-Value	Type
low complexity region	7	24	N/A	INTRINSIC
Blast:MBT	25	52	2e-9	BLAST
PDB:2W0T\|A	52	74	2e-6	PDB
low complexity region	75	90	N/A	INTRINSIC
low complexity region	114	130	N/A	INTRINSIC
PDB:4C5I\|B	131	201	5e-37	PDB
Blast:MBT	144	201	1e-35	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000107852
AA Change: Y122C

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000103484
Gene: ENSMUSG00000059474
AA Change: Y122C

Domain	Start	End	E-Value	Type
low complexity region	7	24	N/A	INTRINSIC
PDB:2W0T\|A	52	74	5e-6	PDB
low complexity region	75	90	N/A	INTRINSIC
low complexity region	114	130	N/A	INTRINSIC
MBT	144	248	3.11e-22	SMART
MBT	256	357	1.28e-41	SMART
MBT	361	433	1.29e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000107853
AA Change: Y122C

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000103485
Gene: ENSMUSG00000059474
AA Change: Y122C

Domain	Start	End	E-Value	Type
low complexity region	7	24	N/A	INTRINSIC
PDB:2W0T\|A	52	74	1e-6	PDB
low complexity region	75	90	N/A	INTRINSIC
low complexity region	114	130	N/A	INTRINSIC
MBT	144	248	1.2e-24	SMART
MBT	256	357	4.8e-44	SMART
MBT	361	459	6.1e-41	SMART
MBT	467	563	1.6e-56	SMART
low complexity region	564	592	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000107854
AA Change: Y122C

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000103486
Gene: ENSMUSG00000059474
AA Change: Y122C

Domain	Start	End	E-Value	Type
low complexity region	7	24	N/A	INTRINSIC
PDB:2W0T\|A	52	74	1e-6	PDB
low complexity region	75	90	N/A	INTRINSIC
low complexity region	114	130	N/A	INTRINSIC
MBT	144	248	1.2e-24	SMART
MBT	256	357	4.9e-44	SMART
MBT	361	459	6.2e-41	SMART
MBT	467	563	1.6e-56	SMART
low complexity region	564	592	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127539

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132739

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140880

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145354

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150237

Meta Mutation Damage Score

0.1133

Coding Region Coverage

1x: 98.7%
3x: 97.4%
10x: 93.1%
20x: 82.0%

Validation Efficiency

98% (81/83)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality and severe abnormalities in hematopoietic stem cell function and skeletal formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ackr2	A	G	9: 121,908,717	S53G	possibly damaging	Het
Adgrb1	T	A	15: 74,550,039	L886Q	probably damaging	Het
Adprhl1	G	A	8: 13,248,624	T102M	probably damaging	Het
Akap6	A	C	12: 52,887,029	K435Q	probably damaging	Het
Aldh7a1	T	C	18: 56,546,950		probably null	Het
Amfr	T	C	8: 93,974,804	R507G	probably benign	Het
Ap1m1	T	A	8: 72,251,875		probably null	Het
Arhgap29	A	G	3: 121,992,395	H275R	probably benign	Het
Arhgef17	C	A	7: 100,881,269	E428*	probably null	Het
Atm	A	T	9: 53,456,530	V2431E	probably damaging	Het
Atn1	G	T	6: 124,747,787	P161Q	unknown	Het
Atp13a2	T	C	4: 140,993,802	S99P	probably damaging	Het
Ccar1	C	A	10: 62,783,882		probably null	Het
Cdk18	T	C	1: 132,119,960		probably benign	Het
Cep85	A	G	4: 134,167,400	W32R	probably damaging	Het
Col5a3	A	G	9: 20,808,418	F215S	unknown	Het
Decr1	T	C	4: 15,919,207	N312S	possibly damaging	Het
Diaph3	A	T	14: 87,007,399	W178R	probably damaging	Het
Dync2h1	A	G	9: 7,075,752		probably benign	Het
Ehd3	C	A	17: 73,828,186	D352E	probably damaging	Het
Enpp6	T	G	8: 47,065,500	I221S	probably benign	Het
Fam186a	T	C	15: 99,939,789		probably benign	Het
Gm5435	G	T	12: 82,495,784		noncoding transcript	Het
Gm6990	T	A	19: 56,755,334		noncoding transcript	Het
Gpr22	A	C	12: 31,709,514	I203S	probably benign	Het
Gpr61	A	G	3: 108,150,481	V288A	possibly damaging	Het
Grik3	G	A	4: 125,704,564		probably benign	Het
Gstcd	T	C	3: 133,005,628	N431D	probably damaging	Het
Haao	T	A	17: 83,838,838	Q69L	probably benign	Het
Hist1h1b	T	C	13: 21,779,999	S186G	probably benign	Het
Ift140	G	T	17: 25,088,933		probably null	Het
Ikbke	A	G	1: 131,270,226	V381A	probably benign	Het
Ing1	A	C	8: 11,561,501	I38L	probably benign	Het
Ing1	T	A	8: 11,561,502	I38N	probably damaging	Het
Itga4	A	G	2: 79,322,689	M907V	possibly damaging	Het
Kcnk12	C	T	17: 87,746,373	G287D	probably damaging	Het
Kmt2e	A	C	5: 23,502,404	H1655P	probably damaging	Het
Mslnl	T	C	17: 25,743,240	L204P	probably damaging	Het
Muc6	T	C	7: 141,651,879	E112G	probably benign	Het
Nav3	T	A	10: 109,692,102	D2240V	probably damaging	Het
Ndufaf3	T	C	9: 108,566,693	T9A	probably damaging	Het
Numb	C	A	12: 83,796,161		probably benign	Het
Prodh2	T	C	7: 30,494,089	V79A	probably damaging	Het
Psmb2	A	G	4: 126,687,032	Y73C	probably damaging	Het
Rmnd5a	G	A	6: 71,398,455	L80F	probably benign	Het
Rnf19a	G	T	15: 36,244,101	Y604*	probably null	Het
Ros1	T	A	10: 52,087,932	E1744V	possibly damaging	Het
Rpusd2	T	C	2: 119,036,927	F219L	probably benign	Het
Sall2	T	C	14: 52,313,725	N671S	probably damaging	Het
Sele	T	A	1: 164,050,810	S239R	probably damaging	Het
Serpina3b	T	C	12: 104,130,879	F140L	probably damaging	Het
Stxbp1	A	T	2: 32,794,636	S594T	probably benign	Het
Sufu	G	A	19: 46,454,720		probably benign	Het
Tbx2	A	G	11: 85,834,766	E181G	probably damaging	Het
Thumpd2	A	G	17: 81,055,888	V50A	probably damaging	Het
Tmem56	A	G	3: 121,207,291	V231A	probably benign	Het
Ttn	C	A	2: 76,743,245	R17441L	probably damaging	Het
Usp34	A	G	11: 23,384,477	Y1157C	probably damaging	Het
Vmn1r9	T	C	6: 57,071,537	V199A	probably damaging	Het
Vmn2r6	A	G	3: 64,538,273	F677S	probably damaging	Het
Vmn2r84	C	T	10: 130,389,139	A501T	probably benign	Het
Wapl	C	T	14: 34,724,769	P605S	probably damaging	Het
Zfp598	A	G	17: 24,679,649	N474S	probably benign	Het
Zfyve26	A	G	12: 79,274,920	L975P	probably damaging	Het
Zp3r	C	T	1: 130,591,444	G255D	probably damaging	Het

Other mutations in Mbtd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00814:Mbtd1	APN	11	93943840	missense	possibly damaging	0.94
IGL00819:Mbtd1	APN	11	93931811	critical splice acceptor site	probably null
IGL01140:Mbtd1	APN	11	93924432	missense	probably damaging	1.00
IGL01553:Mbtd1	APN	11	93923214	missense	probably benign	0.35
IGL01893:Mbtd1	APN	11	93921412	missense	probably null
IGL02218:Mbtd1	APN	11	93931803	splice site	probably benign
IGL02406:Mbtd1	APN	11	93908858	missense	probably damaging	1.00
IGL03002:Mbtd1	APN	11	93924490	missense	probably benign	0.15
IGL03347:Mbtd1	APN	11	93923179	missense	probably benign	0.01
R0027:Mbtd1	UTSW	11	93924549	missense	possibly damaging	0.85
R0027:Mbtd1	UTSW	11	93924549	missense	possibly damaging	0.85
R0311:Mbtd1	UTSW	11	93921357	splice site	probably null
R0513:Mbtd1	UTSW	11	93932212	splice site	probably null
R0646:Mbtd1	UTSW	11	93905212	missense	probably damaging	1.00
R0734:Mbtd1	UTSW	11	93923146	missense	probably damaging	1.00
R0835:Mbtd1	UTSW	11	93931839	missense	probably benign	0.23
R1296:Mbtd1	UTSW	11	93910359	missense	probably damaging	0.99
R1996:Mbtd1	UTSW	11	93932396	frame shift	probably null
R2157:Mbtd1	UTSW	11	93910388	missense	probably benign	0.20
R3977:Mbtd1	UTSW	11	93905175	missense	probably benign
R4435:Mbtd1	UTSW	11	93932222	missense	probably benign
R4589:Mbtd1	UTSW	11	93921419	missense	probably damaging	1.00
R4647:Mbtd1	UTSW	11	93924611	missense	probably damaging	1.00
R4824:Mbtd1	UTSW	11	93925702	missense	probably benign	0.00
R4919:Mbtd1	UTSW	11	93923148	splice site	probably null
R5045:Mbtd1	UTSW	11	93931815	missense	probably benign	0.26
R5095:Mbtd1	UTSW	11	93929671	missense	probably damaging	1.00
R5227:Mbtd1	UTSW	11	93924648	missense	possibly damaging	0.54
R5619:Mbtd1	UTSW	11	93929879	splice site	probably null
R6057:Mbtd1	UTSW	11	93929659	missense	probably damaging	0.99
R6293:Mbtd1	UTSW	11	93932232	missense	possibly damaging	0.79
R6294:Mbtd1	UTSW	11	93932232	missense	possibly damaging	0.79
R6295:Mbtd1	UTSW	11	93932232	missense	possibly damaging	0.79
R6297:Mbtd1	UTSW	11	93932232	missense	possibly damaging	0.79
R6998:Mbtd1	UTSW	11	93924612	missense	probably damaging	1.00
R7423:Mbtd1	UTSW	11	93943796	missense	probably benign	0.38
R7519:Mbtd1	UTSW	11	93908899	missense	probably damaging	1.00
R8250:Mbtd1	UTSW	11	93910350	missense	probably damaging	1.00
R9180:Mbtd1	UTSW	11	93932392	missense	probably damaging	1.00
R9181:Mbtd1	UTSW	11	93912415	missense	probably benign
R9215:Mbtd1	UTSW	11	93943802	missense	possibly damaging	0.67
R9446:Mbtd1	UTSW	11	93943682	missense	unknown
R9474:Mbtd1	UTSW	11	93925685	missense	probably benign
R9575:Mbtd1	UTSW	11	93908938	critical splice donor site	probably null
R9696:Mbtd1	UTSW	11	93932392	missense	probably damaging	1.00
X0024:Mbtd1	UTSW	11	93924549	missense	possibly damaging	0.85
Z1177:Mbtd1	UTSW	11	93912459	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- AGCATTGCTTTGCAACTGCATGAC -3'
(R):5'- GCACACAGTCTAAATGTGCCAACAG -3'

Sequencing Primer
(F):5'- GCATGACTGAATAACCCTGGTTC -3'
(R):5'- GTCTAAATGTGCCAACAGAAAAC -3'

Posted On

2014-02-18