Incidental Mutation 'R1295:Hist1h1b'
ID158086
Institutional Source Beutler Lab
Gene Symbol Hist1h1b
Ensembl Gene ENSMUSG00000058773
Gene Namehistone cluster 1, H1b
SynonymsH1.5, H1B, H1f5, H1s-3
MMRRC Submission 039361-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.464) question?
Stock #R1295 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location21779883-21780625 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21779999 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 186 (S186G)
Ref Sequence ENSEMBL: ENSMUSP00000079356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080511] [ENSMUST00000189457]
Predicted Effect probably benign
Transcript: ENSMUST00000080511
AA Change: S186G

PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000079356
Gene: ENSMUSG00000058773
AA Change: S186G

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
H15 34 99 5.02e-24 SMART
low complexity region 116 223 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189457
SMART Domains Protein: ENSMUSP00000139663
Gene: ENSMUSG00000101972

DomainStartEndE-ValueType
H3 34 136 1.5e-75 SMART
Meta Mutation Damage Score 0.2053 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.4%
  • 10x: 93.1%
  • 20x: 82.0%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: Histones are basic nuclear proteins responsible for nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H1 family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr2 A G 9: 121,908,717 S53G possibly damaging Het
Adgrb1 T A 15: 74,550,039 L886Q probably damaging Het
Adprhl1 G A 8: 13,248,624 T102M probably damaging Het
Akap6 A C 12: 52,887,029 K435Q probably damaging Het
Aldh7a1 T C 18: 56,546,950 probably null Het
Amfr T C 8: 93,974,804 R507G probably benign Het
Ap1m1 T A 8: 72,251,875 probably null Het
Arhgap29 A G 3: 121,992,395 H275R probably benign Het
Arhgef17 C A 7: 100,881,269 E428* probably null Het
Atm A T 9: 53,456,530 V2431E probably damaging Het
Atn1 G T 6: 124,747,787 P161Q unknown Het
Atp13a2 T C 4: 140,993,802 S99P probably damaging Het
Ccar1 C A 10: 62,783,882 probably null Het
Cdk18 T C 1: 132,119,960 probably benign Het
Cep85 A G 4: 134,167,400 W32R probably damaging Het
Col5a3 A G 9: 20,808,418 F215S unknown Het
Decr1 T C 4: 15,919,207 N312S possibly damaging Het
Diaph3 A T 14: 87,007,399 W178R probably damaging Het
Dync2h1 A G 9: 7,075,752 probably benign Het
Ehd3 C A 17: 73,828,186 D352E probably damaging Het
Enpp6 T G 8: 47,065,500 I221S probably benign Het
Fam186a T C 15: 99,939,789 probably benign Het
Gm5435 G T 12: 82,495,784 noncoding transcript Het
Gm6990 T A 19: 56,755,334 noncoding transcript Het
Gpr22 A C 12: 31,709,514 I203S probably benign Het
Gpr61 A G 3: 108,150,481 V288A possibly damaging Het
Grik3 G A 4: 125,704,564 probably benign Het
Gstcd T C 3: 133,005,628 N431D probably damaging Het
Haao T A 17: 83,838,838 Q69L probably benign Het
Ift140 G T 17: 25,088,933 probably null Het
Ikbke A G 1: 131,270,226 V381A probably benign Het
Ing1 A C 8: 11,561,501 I38L probably benign Het
Ing1 T A 8: 11,561,502 I38N probably damaging Het
Itga4 A G 2: 79,322,689 M907V possibly damaging Het
Kcnk12 C T 17: 87,746,373 G287D probably damaging Het
Kmt2e A C 5: 23,502,404 H1655P probably damaging Het
Mbtd1 A G 11: 93,910,359 Y122C probably damaging Het
Mslnl T C 17: 25,743,240 L204P probably damaging Het
Muc6 T C 7: 141,651,879 E112G probably benign Het
Nav3 T A 10: 109,692,102 D2240V probably damaging Het
Ndufaf3 T C 9: 108,566,693 T9A probably damaging Het
Numb C A 12: 83,796,161 probably benign Het
Prodh2 T C 7: 30,494,089 V79A probably damaging Het
Psmb2 A G 4: 126,687,032 Y73C probably damaging Het
Rmnd5a G A 6: 71,398,455 L80F probably benign Het
Rnf19a G T 15: 36,244,101 Y604* probably null Het
Ros1 T A 10: 52,087,932 E1744V possibly damaging Het
Rpusd2 T C 2: 119,036,927 F219L probably benign Het
Sall2 T C 14: 52,313,725 N671S probably damaging Het
Sele T A 1: 164,050,810 S239R probably damaging Het
Serpina3b T C 12: 104,130,879 F140L probably damaging Het
Stxbp1 A T 2: 32,794,636 S594T probably benign Het
Sufu G A 19: 46,454,720 probably benign Het
Tbx2 A G 11: 85,834,766 E181G probably damaging Het
Thumpd2 A G 17: 81,055,888 V50A probably damaging Het
Tmem56 A G 3: 121,207,291 V231A probably benign Het
Ttn C A 2: 76,743,245 R17441L probably damaging Het
Usp34 A G 11: 23,384,477 Y1157C probably damaging Het
Vmn1r9 T C 6: 57,071,537 V199A probably damaging Het
Vmn2r6 A G 3: 64,538,273 F677S probably damaging Het
Vmn2r84 C T 10: 130,389,139 A501T probably benign Het
Wapl C T 14: 34,724,769 P605S probably damaging Het
Zfp598 A G 17: 24,679,649 N474S probably benign Het
Zfyve26 A G 12: 79,274,920 L975P probably damaging Het
Zp3r C T 1: 130,591,444 G255D probably damaging Het
Other mutations in Hist1h1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03026:Hist1h1b APN 13 21779947 unclassified probably benign
R1104:Hist1h1b UTSW 13 21780281 missense possibly damaging 0.66
R3120:Hist1h1b UTSW 13 21780045 missense probably benign 0.23
R3147:Hist1h1b UTSW 13 21780115 unclassified probably benign
R4222:Hist1h1b UTSW 13 21779977 unclassified probably benign
R4597:Hist1h1b UTSW 13 21780511 missense probably damaging 0.96
R6289:Hist1h1b UTSW 13 21780439 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAATCGTGGCAGATAAGGGTTCCAG -3'
(R):5'- CTTCAAGCTTAACAAGAAGGCGGC -3'

Sequencing Primer
(F):5'- GTGTACAGCTACATTCACAGAGC -3'
(R):5'- CTTAACAAGAAGGCGGCTTCTG -3'
Posted On2014-02-18