Incidental Mutation 'R1295:Wapl'
ID 158087
Institutional Source Beutler Lab
Gene Symbol Wapl
Ensembl Gene ENSMUSG00000041408
Gene Name WAPL cohesin release factor
Synonyms A530089A20Rik, Wapal
MMRRC Submission 039361-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1295 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 34395885-34469940 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 34446726 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 605 (P605S)
Ref Sequence ENSEMBL: ENSMUSP00000087481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048263] [ENSMUST00000090027] [ENSMUST00000169910]
AlphaFold Q65Z40
Predicted Effect possibly damaging
Transcript: ENSMUST00000048263
AA Change: P611S

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000040232
Gene: ENSMUSG00000041408
AA Change: P611S

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 645 1009 6.5e-153 PFAM
low complexity region 1018 1033 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000090027
AA Change: P605S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000087481
Gene: ENSMUSG00000041408
AA Change: P605S

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 639 1003 2.6e-153 PFAM
low complexity region 1012 1027 N/A INTRINSIC
low complexity region 1095 1106 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000111895
Predicted Effect probably benign
Transcript: ENSMUST00000151285
SMART Domains Protein: ENSMUSP00000117282
Gene: ENSMUSG00000041408

DomainStartEndE-ValueType
Pfam:WAPL 1 281 1.1e-78 PFAM
coiled coil region 329 351 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169910
AA Change: P611S

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000130547
Gene: ENSMUSG00000041408
AA Change: P611S

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 647 1008 3.5e-120 PFAM
low complexity region 1018 1033 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172658
Meta Mutation Damage Score 0.2208 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.4%
  • 10x: 93.1%
  • 20x: 82.0%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: Studies suggest that the protein encoded by this gene is important for the release of cohesin from chromatin. This gene product is thought to be essential for development, and reduced expression of this gene in cells causes defects in chromatin structure. High levels of expression of the human ortholog of this gene are observed in cervical cancers, and expression of the human ortholog of this gene in mice results in tumor formation. Alternative splicing results in multiple transcript variants encoding different protein isoforms. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a targeted allele exhibit prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr2 A G 9: 121,737,783 (GRCm39) S53G possibly damaging Het
Adgrb1 T A 15: 74,421,888 (GRCm39) L886Q probably damaging Het
Adprhl1 G A 8: 13,298,624 (GRCm39) T102M probably damaging Het
Akap6 A C 12: 52,933,812 (GRCm39) K435Q probably damaging Het
Aldh7a1 T C 18: 56,680,022 (GRCm39) probably null Het
Amfr T C 8: 94,701,432 (GRCm39) R507G probably benign Het
Ap1m1 T A 8: 73,005,719 (GRCm39) probably null Het
Arhgap29 A G 3: 121,786,044 (GRCm39) H275R probably benign Het
Arhgef17 C A 7: 100,530,476 (GRCm39) E428* probably null Het
Atm A T 9: 53,367,830 (GRCm39) V2431E probably damaging Het
Atn1 G T 6: 124,724,750 (GRCm39) P161Q unknown Het
Atp13a2 T C 4: 140,721,113 (GRCm39) S99P probably damaging Het
Ccar1 C A 10: 62,619,661 (GRCm39) probably null Het
Cdk18 T C 1: 132,047,698 (GRCm39) probably benign Het
Cep85 A G 4: 133,894,711 (GRCm39) W32R probably damaging Het
Col5a3 A G 9: 20,719,714 (GRCm39) F215S unknown Het
Decr1 T C 4: 15,919,207 (GRCm39) N312S possibly damaging Het
Diaph3 A T 14: 87,244,835 (GRCm39) W178R probably damaging Het
Dync2h1 A G 9: 7,075,752 (GRCm39) probably benign Het
Ehd3 C A 17: 74,135,181 (GRCm39) D352E probably damaging Het
Enpp6 T G 8: 47,518,535 (GRCm39) I221S probably benign Het
Fam186a T C 15: 99,837,670 (GRCm39) probably benign Het
Gm5435 G T 12: 82,542,558 (GRCm39) noncoding transcript Het
Gpr22 A C 12: 31,759,513 (GRCm39) I203S probably benign Het
Gpr61 A G 3: 108,057,797 (GRCm39) V288A possibly damaging Het
Grik3 G A 4: 125,598,357 (GRCm39) probably benign Het
Gstcd T C 3: 132,711,389 (GRCm39) N431D probably damaging Het
H1f5 T C 13: 21,964,169 (GRCm39) S186G probably benign Het
Haao T A 17: 84,146,267 (GRCm39) Q69L probably benign Het
Ift140 G T 17: 25,307,907 (GRCm39) probably null Het
Ikbke A G 1: 131,197,963 (GRCm39) V381A probably benign Het
Ing1 T A 8: 11,611,502 (GRCm39) I38N probably damaging Het
Ing1 A C 8: 11,611,501 (GRCm39) I38L probably benign Het
Itga4 A G 2: 79,153,033 (GRCm39) M907V possibly damaging Het
Kcnk12 C T 17: 88,053,801 (GRCm39) G287D probably damaging Het
Kmt2e A C 5: 23,707,402 (GRCm39) H1655P probably damaging Het
Mbtd1 A G 11: 93,801,185 (GRCm39) Y122C probably damaging Het
Mif-ps9 T A 19: 56,743,766 (GRCm39) noncoding transcript Het
Mslnl T C 17: 25,962,214 (GRCm39) L204P probably damaging Het
Muc6 T C 7: 141,238,144 (GRCm39) E112G probably benign Het
Nav3 T A 10: 109,527,963 (GRCm39) D2240V probably damaging Het
Ndufaf3 T C 9: 108,443,892 (GRCm39) T9A probably damaging Het
Numb C A 12: 83,842,935 (GRCm39) probably benign Het
Prodh2 T C 7: 30,193,514 (GRCm39) V79A probably damaging Het
Psmb2 A G 4: 126,580,825 (GRCm39) Y73C probably damaging Het
Rmnd5a G A 6: 71,375,439 (GRCm39) L80F probably benign Het
Rnf19a G T 15: 36,244,247 (GRCm39) Y604* probably null Het
Ros1 T A 10: 51,964,028 (GRCm39) E1744V possibly damaging Het
Rpusd2 T C 2: 118,867,408 (GRCm39) F219L probably benign Het
Sall2 T C 14: 52,551,182 (GRCm39) N671S probably damaging Het
Sele T A 1: 163,878,379 (GRCm39) S239R probably damaging Het
Serpina3b T C 12: 104,097,138 (GRCm39) F140L probably damaging Het
Stxbp1 A T 2: 32,684,648 (GRCm39) S594T probably benign Het
Sufu G A 19: 46,443,159 (GRCm39) probably benign Het
Tbx2 A G 11: 85,725,592 (GRCm39) E181G probably damaging Het
Thumpd2 A G 17: 81,363,317 (GRCm39) V50A probably damaging Het
Tlcd4 A G 3: 121,000,940 (GRCm39) V231A probably benign Het
Ttn C A 2: 76,573,589 (GRCm39) R17441L probably damaging Het
Usp34 A G 11: 23,334,477 (GRCm39) Y1157C probably damaging Het
Vmn1r9 T C 6: 57,048,522 (GRCm39) V199A probably damaging Het
Vmn2r6 A G 3: 64,445,694 (GRCm39) F677S probably damaging Het
Vmn2r84 C T 10: 130,225,008 (GRCm39) A501T probably benign Het
Zfp598 A G 17: 24,898,623 (GRCm39) N474S probably benign Het
Zfyve26 A G 12: 79,321,694 (GRCm39) L975P probably damaging Het
Zp3r C T 1: 130,519,181 (GRCm39) G255D probably damaging Het
Other mutations in Wapl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Wapl APN 14 34,414,593 (GRCm39) missense probably benign 0.00
IGL00539:Wapl APN 14 34,416,965 (GRCm39) missense probably damaging 1.00
IGL00846:Wapl APN 14 34,414,701 (GRCm39) splice site probably benign
IGL01070:Wapl APN 14 34,467,579 (GRCm39) unclassified probably benign
IGL01516:Wapl APN 14 34,414,038 (GRCm39) missense probably damaging 1.00
IGL02021:Wapl APN 14 34,444,293 (GRCm39) missense probably benign
IGL02209:Wapl APN 14 34,399,218 (GRCm39) missense possibly damaging 0.46
IGL02309:Wapl APN 14 34,466,820 (GRCm39) missense probably damaging 0.98
IGL02471:Wapl APN 14 34,413,877 (GRCm39) missense possibly damaging 0.68
IGL02965:Wapl APN 14 34,461,181 (GRCm39) intron probably benign
IGL03076:Wapl APN 14 34,414,046 (GRCm39) missense probably benign 0.26
IGL03197:Wapl APN 14 34,467,588 (GRCm39) missense possibly damaging 0.77
Mcclintock UTSW 14 34,452,619 (GRCm39) critical splice donor site probably null
Tatum UTSW 14 34,451,152 (GRCm39) missense probably damaging 1.00
R0045:Wapl UTSW 14 34,455,751 (GRCm39) missense probably benign 0.18
R0278:Wapl UTSW 14 34,414,569 (GRCm39) missense possibly damaging 0.68
R0335:Wapl UTSW 14 34,414,281 (GRCm39) missense probably damaging 0.99
R1018:Wapl UTSW 14 34,413,863 (GRCm39) missense possibly damaging 0.91
R1553:Wapl UTSW 14 34,451,147 (GRCm39) missense probably damaging 1.00
R1868:Wapl UTSW 14 34,414,415 (GRCm39) missense probably benign 0.00
R1909:Wapl UTSW 14 34,413,869 (GRCm39) missense probably damaging 1.00
R2698:Wapl UTSW 14 34,413,734 (GRCm39) missense probably benign
R2990:Wapl UTSW 14 34,458,665 (GRCm39) missense probably damaging 0.98
R3121:Wapl UTSW 14 34,451,172 (GRCm39) missense possibly damaging 0.93
R3122:Wapl UTSW 14 34,451,172 (GRCm39) missense possibly damaging 0.93
R3147:Wapl UTSW 14 34,447,106 (GRCm39) missense probably damaging 1.00
R3732:Wapl UTSW 14 34,458,721 (GRCm39) missense probably damaging 0.99
R3732:Wapl UTSW 14 34,458,721 (GRCm39) missense probably damaging 0.99
R3733:Wapl UTSW 14 34,458,721 (GRCm39) missense probably damaging 0.99
R3878:Wapl UTSW 14 34,414,104 (GRCm39) missense probably damaging 1.00
R4034:Wapl UTSW 14 34,459,871 (GRCm39) missense possibly damaging 0.92
R4934:Wapl UTSW 14 34,414,052 (GRCm39) missense probably benign 0.11
R5079:Wapl UTSW 14 34,446,714 (GRCm39) missense probably damaging 1.00
R5104:Wapl UTSW 14 34,414,016 (GRCm39) nonsense probably null
R5113:Wapl UTSW 14 34,446,711 (GRCm39) missense probably damaging 1.00
R5121:Wapl UTSW 14 34,399,119 (GRCm39) missense probably benign 0.01
R5222:Wapl UTSW 14 34,458,642 (GRCm39) nonsense probably null
R5299:Wapl UTSW 14 34,455,765 (GRCm39) critical splice donor site probably null
R5387:Wapl UTSW 14 34,399,252 (GRCm39) missense probably benign 0.00
R5541:Wapl UTSW 14 34,452,619 (GRCm39) critical splice donor site probably null
R5618:Wapl UTSW 14 34,413,863 (GRCm39) missense possibly damaging 0.91
R5802:Wapl UTSW 14 34,414,277 (GRCm39) missense probably damaging 1.00
R6029:Wapl UTSW 14 34,461,204 (GRCm39) missense possibly damaging 0.94
R6292:Wapl UTSW 14 34,451,152 (GRCm39) missense probably damaging 1.00
R6482:Wapl UTSW 14 34,414,649 (GRCm39) missense probably benign 0.01
R6487:Wapl UTSW 14 34,414,249 (GRCm39) missense probably damaging 1.00
R6925:Wapl UTSW 14 34,399,320 (GRCm39) missense probably benign 0.31
R6937:Wapl UTSW 14 34,444,311 (GRCm39) missense probably benign 0.01
R7080:Wapl UTSW 14 34,414,313 (GRCm39) missense probably benign 0.03
R7203:Wapl UTSW 14 34,458,648 (GRCm39) missense probably benign
R7944:Wapl UTSW 14 34,399,105 (GRCm39) missense probably benign 0.00
R7945:Wapl UTSW 14 34,399,105 (GRCm39) missense probably benign 0.00
R7969:Wapl UTSW 14 34,452,604 (GRCm39) missense probably damaging 1.00
R8038:Wapl UTSW 14 34,413,639 (GRCm39) missense probably benign
R8053:Wapl UTSW 14 34,414,278 (GRCm39) missense probably damaging 1.00
R8688:Wapl UTSW 14 34,414,549 (GRCm39) missense possibly damaging 0.94
R8864:Wapl UTSW 14 34,414,159 (GRCm39) missense probably benign 0.03
R8988:Wapl UTSW 14 34,451,139 (GRCm39) missense probably damaging 1.00
R9072:Wapl UTSW 14 34,399,417 (GRCm39) missense possibly damaging 0.81
R9197:Wapl UTSW 14 34,444,244 (GRCm39) missense probably damaging 1.00
R9259:Wapl UTSW 14 34,463,052 (GRCm39) missense probably benign 0.00
R9545:Wapl UTSW 14 34,399,050 (GRCm39) missense probably damaging 1.00
R9613:Wapl UTSW 14 34,453,520 (GRCm39) missense probably benign 0.29
R9624:Wapl UTSW 14 34,414,063 (GRCm39) missense possibly damaging 0.89
Z1177:Wapl UTSW 14 34,467,647 (GRCm39) makesense probably null
Predicted Primers PCR Primer
(F):5'- TAGGAACTTTCAGCAGCCTCCCTC -3'
(R):5'- AGCCCGCCTCTTGGTAACTTTAGC -3'

Sequencing Primer
(F):5'- AGCAGCCTCCCTCTTCCC -3'
(R):5'- CCTATAAAATCACTCATTCGATGGC -3'
Posted On 2014-02-18