Mutagenetix > Incidental Mutation

Incidental Mutation 'R1295:Wapl'

158087

Institutional Source

Beutler Lab

Gene Symbol

Wapl

Ensembl Gene

ENSMUSG00000041408

Gene Name

WAPL cohesin release factor

Synonyms

A530089A20Rik, Wapal

MMRRC Submission

039361-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1295 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

34673928-34747983 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 34724769 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 605 (P605S)

Ref Sequence

ENSEMBL: ENSMUSP00000087481 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048263] [ENSMUST00000090027] [ENSMUST00000169910]

AlphaFold

Q65Z40

Predicted Effect

possibly damaging
Transcript: ENSMUST00000048263
AA Change: P611S

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000040232
Gene: ENSMUSG00000041408
AA Change: P611S

Domain	Start	End	E-Value	Type
low complexity region	436	455	N/A	INTRINSIC
low complexity region	465	477	N/A	INTRINSIC
low complexity region	493	513	N/A	INTRINSIC
Pfam:WAPL	645	1009	6.5e-153	PFAM
low complexity region	1018	1033	N/A	INTRINSIC
low complexity region	1101	1112	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000090027
AA Change: P605S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000087481
Gene: ENSMUSG00000041408
AA Change: P605S

Domain	Start	End	E-Value	Type
low complexity region	436	455	N/A	INTRINSIC
low complexity region	465	477	N/A	INTRINSIC
low complexity region	493	513	N/A	INTRINSIC
Pfam:WAPL	639	1003	2.6e-153	PFAM
low complexity region	1012	1027	N/A	INTRINSIC
low complexity region	1095	1106	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000111895

Predicted Effect

probably benign
Transcript: ENSMUST00000151285

SMART Domains

Protein: ENSMUSP00000117282
Gene: ENSMUSG00000041408

Domain	Start	End	E-Value	Type
Pfam:WAPL	1	281	1.1e-78	PFAM
coiled coil region	329	351	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000169910
AA Change: P611S

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000130547
Gene: ENSMUSG00000041408
AA Change: P611S

Domain	Start	End	E-Value	Type
low complexity region	436	455	N/A	INTRINSIC
low complexity region	465	477	N/A	INTRINSIC
low complexity region	493	513	N/A	INTRINSIC
Pfam:WAPL	647	1008	3.5e-120	PFAM
low complexity region	1018	1033	N/A	INTRINSIC
low complexity region	1101	1112	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172658

Meta Mutation Damage Score

0.2208

Coding Region Coverage

1x: 98.7%
3x: 97.4%
10x: 93.1%
20x: 82.0%

Validation Efficiency

98% (81/83)

MGI Phenotype

FUNCTION: Studies suggest that the protein encoded by this gene is important for the release of cohesin from chromatin. This gene product is thought to be essential for development, and reduced expression of this gene in cells causes defects in chromatin structure. High levels of expression of the human ortholog of this gene are observed in cervical cancers, and expression of the human ortholog of this gene in mice results in tumor formation. Alternative splicing results in multiple transcript variants encoding different protein isoforms. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a targeted allele exhibit prenatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ackr2	A	G	9: 121,908,717	S53G	possibly damaging	Het
Adgrb1	T	A	15: 74,550,039	L886Q	probably damaging	Het
Adprhl1	G	A	8: 13,248,624	T102M	probably damaging	Het
Akap6	A	C	12: 52,887,029	K435Q	probably damaging	Het
Aldh7a1	T	C	18: 56,546,950		probably null	Het
Amfr	T	C	8: 93,974,804	R507G	probably benign	Het
Ap1m1	T	A	8: 72,251,875		probably null	Het
Arhgap29	A	G	3: 121,992,395	H275R	probably benign	Het
Arhgef17	C	A	7: 100,881,269	E428*	probably null	Het
Atm	A	T	9: 53,456,530	V2431E	probably damaging	Het
Atn1	G	T	6: 124,747,787	P161Q	unknown	Het
Atp13a2	T	C	4: 140,993,802	S99P	probably damaging	Het
Ccar1	C	A	10: 62,783,882		probably null	Het
Cdk18	T	C	1: 132,119,960		probably benign	Het
Cep85	A	G	4: 134,167,400	W32R	probably damaging	Het
Col5a3	A	G	9: 20,808,418	F215S	unknown	Het
Decr1	T	C	4: 15,919,207	N312S	possibly damaging	Het
Diaph3	A	T	14: 87,007,399	W178R	probably damaging	Het
Dync2h1	A	G	9: 7,075,752		probably benign	Het
Ehd3	C	A	17: 73,828,186	D352E	probably damaging	Het
Enpp6	T	G	8: 47,065,500	I221S	probably benign	Het
Fam186a	T	C	15: 99,939,789		probably benign	Het
Gm5435	G	T	12: 82,495,784		noncoding transcript	Het
Gm6990	T	A	19: 56,755,334		noncoding transcript	Het
Gpr22	A	C	12: 31,709,514	I203S	probably benign	Het
Gpr61	A	G	3: 108,150,481	V288A	possibly damaging	Het
Grik3	G	A	4: 125,704,564		probably benign	Het
Gstcd	T	C	3: 133,005,628	N431D	probably damaging	Het
Haao	T	A	17: 83,838,838	Q69L	probably benign	Het
Hist1h1b	T	C	13: 21,779,999	S186G	probably benign	Het
Ift140	G	T	17: 25,088,933		probably null	Het
Ikbke	A	G	1: 131,270,226	V381A	probably benign	Het
Ing1	A	C	8: 11,561,501	I38L	probably benign	Het
Ing1	T	A	8: 11,561,502	I38N	probably damaging	Het
Itga4	A	G	2: 79,322,689	M907V	possibly damaging	Het
Kcnk12	C	T	17: 87,746,373	G287D	probably damaging	Het
Kmt2e	A	C	5: 23,502,404	H1655P	probably damaging	Het
Mbtd1	A	G	11: 93,910,359	Y122C	probably damaging	Het
Mslnl	T	C	17: 25,743,240	L204P	probably damaging	Het
Muc6	T	C	7: 141,651,879	E112G	probably benign	Het
Nav3	T	A	10: 109,692,102	D2240V	probably damaging	Het
Ndufaf3	T	C	9: 108,566,693	T9A	probably damaging	Het
Numb	C	A	12: 83,796,161		probably benign	Het
Prodh2	T	C	7: 30,494,089	V79A	probably damaging	Het
Psmb2	A	G	4: 126,687,032	Y73C	probably damaging	Het
Rmnd5a	G	A	6: 71,398,455	L80F	probably benign	Het
Rnf19a	G	T	15: 36,244,101	Y604*	probably null	Het
Ros1	T	A	10: 52,087,932	E1744V	possibly damaging	Het
Rpusd2	T	C	2: 119,036,927	F219L	probably benign	Het
Sall2	T	C	14: 52,313,725	N671S	probably damaging	Het
Sele	T	A	1: 164,050,810	S239R	probably damaging	Het
Serpina3b	T	C	12: 104,130,879	F140L	probably damaging	Het
Stxbp1	A	T	2: 32,794,636	S594T	probably benign	Het
Sufu	G	A	19: 46,454,720		probably benign	Het
Tbx2	A	G	11: 85,834,766	E181G	probably damaging	Het
Thumpd2	A	G	17: 81,055,888	V50A	probably damaging	Het
Tmem56	A	G	3: 121,207,291	V231A	probably benign	Het
Ttn	C	A	2: 76,743,245	R17441L	probably damaging	Het
Usp34	A	G	11: 23,384,477	Y1157C	probably damaging	Het
Vmn1r9	T	C	6: 57,071,537	V199A	probably damaging	Het
Vmn2r6	A	G	3: 64,538,273	F677S	probably damaging	Het
Vmn2r84	C	T	10: 130,389,139	A501T	probably benign	Het
Zfp598	A	G	17: 24,679,649	N474S	probably benign	Het
Zfyve26	A	G	12: 79,274,920	L975P	probably damaging	Het
Zp3r	C	T	1: 130,591,444	G255D	probably damaging	Het

Other mutations in Wapl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00335:Wapl	APN	14	34692636	missense	probably benign	0.00
IGL00539:Wapl	APN	14	34695008	missense	probably damaging	1.00
IGL00846:Wapl	APN	14	34692744	splice site	probably benign
IGL01070:Wapl	APN	14	34745622	unclassified	probably benign
IGL01516:Wapl	APN	14	34692081	missense	probably damaging	1.00
IGL02021:Wapl	APN	14	34722336	missense	probably benign
IGL02209:Wapl	APN	14	34677261	missense	possibly damaging	0.46
IGL02309:Wapl	APN	14	34744863	missense	probably damaging	0.98
IGL02471:Wapl	APN	14	34691920	missense	possibly damaging	0.68
IGL02965:Wapl	APN	14	34739224	intron	probably benign
IGL03076:Wapl	APN	14	34692089	missense	probably benign	0.26
IGL03197:Wapl	APN	14	34745631	missense	possibly damaging	0.77
Mcclintock	UTSW	14	34730662	critical splice donor site	probably null
Tatum	UTSW	14	34729195	missense	probably damaging	1.00
R0045:Wapl	UTSW	14	34733794	missense	probably benign	0.18
R0278:Wapl	UTSW	14	34692612	missense	possibly damaging	0.68
R0335:Wapl	UTSW	14	34692324	missense	probably damaging	0.99
R1018:Wapl	UTSW	14	34691906	missense	possibly damaging	0.91
R1553:Wapl	UTSW	14	34729190	missense	probably damaging	1.00
R1868:Wapl	UTSW	14	34692458	missense	probably benign	0.00
R1909:Wapl	UTSW	14	34691912	missense	probably damaging	1.00
R2698:Wapl	UTSW	14	34691777	missense	probably benign
R2990:Wapl	UTSW	14	34736708	missense	probably damaging	0.98
R3121:Wapl	UTSW	14	34729215	missense	possibly damaging	0.93
R3122:Wapl	UTSW	14	34729215	missense	possibly damaging	0.93
R3147:Wapl	UTSW	14	34725149	missense	probably damaging	1.00
R3732:Wapl	UTSW	14	34736764	missense	probably damaging	0.99
R3732:Wapl	UTSW	14	34736764	missense	probably damaging	0.99
R3733:Wapl	UTSW	14	34736764	missense	probably damaging	0.99
R3878:Wapl	UTSW	14	34692147	missense	probably damaging	1.00
R4034:Wapl	UTSW	14	34737914	missense	possibly damaging	0.92
R4934:Wapl	UTSW	14	34692095	missense	probably benign	0.11
R5079:Wapl	UTSW	14	34724757	missense	probably damaging	1.00
R5104:Wapl	UTSW	14	34692059	nonsense	probably null
R5113:Wapl	UTSW	14	34724754	missense	probably damaging	1.00
R5121:Wapl	UTSW	14	34677162	missense	probably benign	0.01
R5222:Wapl	UTSW	14	34736685	nonsense	probably null
R5299:Wapl	UTSW	14	34733808	critical splice donor site	probably null
R5387:Wapl	UTSW	14	34677295	missense	probably benign	0.00
R5541:Wapl	UTSW	14	34730662	critical splice donor site	probably null
R5618:Wapl	UTSW	14	34691906	missense	possibly damaging	0.91
R5802:Wapl	UTSW	14	34692320	missense	probably damaging	1.00
R6029:Wapl	UTSW	14	34739247	missense	possibly damaging	0.94
R6292:Wapl	UTSW	14	34729195	missense	probably damaging	1.00
R6482:Wapl	UTSW	14	34692692	missense	probably benign	0.01
R6487:Wapl	UTSW	14	34692292	missense	probably damaging	1.00
R6925:Wapl	UTSW	14	34677363	missense	probably benign	0.31
R6937:Wapl	UTSW	14	34722354	missense	probably benign	0.01
R7080:Wapl	UTSW	14	34692356	missense	probably benign	0.03
R7203:Wapl	UTSW	14	34736691	missense	probably benign
R7944:Wapl	UTSW	14	34677148	missense	probably benign	0.00
R7945:Wapl	UTSW	14	34677148	missense	probably benign	0.00
R7969:Wapl	UTSW	14	34730647	missense	probably damaging	1.00
R8038:Wapl	UTSW	14	34691682	missense	probably benign
R8053:Wapl	UTSW	14	34692321	missense	probably damaging	1.00
R8688:Wapl	UTSW	14	34692592	missense	possibly damaging	0.94
R8864:Wapl	UTSW	14	34692202	missense	probably benign	0.03
R8988:Wapl	UTSW	14	34729182	missense	probably damaging	1.00
R9072:Wapl	UTSW	14	34677460	missense	possibly damaging	0.81
R9197:Wapl	UTSW	14	34722287	missense	probably damaging	1.00
R9259:Wapl	UTSW	14	34741095	missense	probably benign	0.00
R9545:Wapl	UTSW	14	34677093	missense	probably damaging	1.00
R9613:Wapl	UTSW	14	34731563	missense	probably benign	0.29
R9624:Wapl	UTSW	14	34692106	missense	possibly damaging	0.89
Z1177:Wapl	UTSW	14	34745690	makesense	probably null

Predicted Primers

PCR Primer
(F):5'- TAGGAACTTTCAGCAGCCTCCCTC -3'
(R):5'- AGCCCGCCTCTTGGTAACTTTAGC -3'

Sequencing Primer
(F):5'- AGCAGCCTCCCTCTTCCC -3'
(R):5'- CCTATAAAATCACTCATTCGATGGC -3'

Posted On

2014-02-18