Incidental Mutation 'R1295:Sall2'
ID158088
Institutional Source Beutler Lab
Gene Symbol Sall2
Ensembl Gene ENSMUSG00000049532
Gene Namespalt like transcription factor 2
SynonymsMsal-2
MMRRC Submission 039361-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1295 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location52311172-52328762 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 52313725 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 671 (N671S)
Ref Sequence ENSEMBL: ENSMUSP00000056401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058326] [ENSMUST00000135523]
Predicted Effect probably damaging
Transcript: ENSMUST00000058326
AA Change: N671S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056401
Gene: ENSMUSG00000049532
AA Change: N671S

DomainStartEndE-ValueType
low complexity region 71 81 N/A INTRINSIC
low complexity region 97 110 N/A INTRINSIC
low complexity region 128 139 N/A INTRINSIC
low complexity region 151 170 N/A INTRINSIC
ZnF_C2H2 372 394 2.57e-3 SMART
ZnF_C2H2 400 422 1.28e-3 SMART
low complexity region 476 501 N/A INTRINSIC
low complexity region 602 627 N/A INTRINSIC
ZnF_C2H2 629 651 1.2e1 SMART
ZnF_C2H2 657 679 1.69e-3 SMART
ZnF_C2H2 689 711 6.88e-4 SMART
low complexity region 719 730 N/A INTRINSIC
low complexity region 747 779 N/A INTRINSIC
low complexity region 799 819 N/A INTRINSIC
low complexity region 829 848 N/A INTRINSIC
ZnF_C2H2 908 930 2.09e-3 SMART
ZnF_C2H2 937 960 1.01e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000135523
AA Change: N669S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.2387 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.4%
  • 10x: 93.1%
  • 20x: 82.0%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple zinc finger domains. The encoded protein functions in optical fissure closure during development of the eye in the embryo. Mutations in this gene are associated with ocular coloboma. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in no apparent abnormal phenotypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr2 A G 9: 121,908,717 S53G possibly damaging Het
Adgrb1 T A 15: 74,550,039 L886Q probably damaging Het
Adprhl1 G A 8: 13,248,624 T102M probably damaging Het
Akap6 A C 12: 52,887,029 K435Q probably damaging Het
Aldh7a1 T C 18: 56,546,950 probably null Het
Amfr T C 8: 93,974,804 R507G probably benign Het
Ap1m1 T A 8: 72,251,875 probably null Het
Arhgap29 A G 3: 121,992,395 H275R probably benign Het
Arhgef17 C A 7: 100,881,269 E428* probably null Het
Atm A T 9: 53,456,530 V2431E probably damaging Het
Atn1 G T 6: 124,747,787 P161Q unknown Het
Atp13a2 T C 4: 140,993,802 S99P probably damaging Het
Ccar1 C A 10: 62,783,882 probably null Het
Cdk18 T C 1: 132,119,960 probably benign Het
Cep85 A G 4: 134,167,400 W32R probably damaging Het
Col5a3 A G 9: 20,808,418 F215S unknown Het
Decr1 T C 4: 15,919,207 N312S possibly damaging Het
Diaph3 A T 14: 87,007,399 W178R probably damaging Het
Dync2h1 A G 9: 7,075,752 probably benign Het
Ehd3 C A 17: 73,828,186 D352E probably damaging Het
Enpp6 T G 8: 47,065,500 I221S probably benign Het
Fam186a T C 15: 99,939,789 probably benign Het
Gm5435 G T 12: 82,495,784 noncoding transcript Het
Gm6990 T A 19: 56,755,334 noncoding transcript Het
Gpr22 A C 12: 31,709,514 I203S probably benign Het
Gpr61 A G 3: 108,150,481 V288A possibly damaging Het
Grik3 G A 4: 125,704,564 probably benign Het
Gstcd T C 3: 133,005,628 N431D probably damaging Het
Haao T A 17: 83,838,838 Q69L probably benign Het
Hist1h1b T C 13: 21,779,999 S186G probably benign Het
Ift140 G T 17: 25,088,933 probably null Het
Ikbke A G 1: 131,270,226 V381A probably benign Het
Ing1 A C 8: 11,561,501 I38L probably benign Het
Ing1 T A 8: 11,561,502 I38N probably damaging Het
Itga4 A G 2: 79,322,689 M907V possibly damaging Het
Kcnk12 C T 17: 87,746,373 G287D probably damaging Het
Kmt2e A C 5: 23,502,404 H1655P probably damaging Het
Mbtd1 A G 11: 93,910,359 Y122C probably damaging Het
Mslnl T C 17: 25,743,240 L204P probably damaging Het
Muc6 T C 7: 141,651,879 E112G probably benign Het
Nav3 T A 10: 109,692,102 D2240V probably damaging Het
Ndufaf3 T C 9: 108,566,693 T9A probably damaging Het
Numb C A 12: 83,796,161 probably benign Het
Prodh2 T C 7: 30,494,089 V79A probably damaging Het
Psmb2 A G 4: 126,687,032 Y73C probably damaging Het
Rmnd5a G A 6: 71,398,455 L80F probably benign Het
Rnf19a G T 15: 36,244,101 Y604* probably null Het
Ros1 T A 10: 52,087,932 E1744V possibly damaging Het
Rpusd2 T C 2: 119,036,927 F219L probably benign Het
Sele T A 1: 164,050,810 S239R probably damaging Het
Serpina3b T C 12: 104,130,879 F140L probably damaging Het
Stxbp1 A T 2: 32,794,636 S594T probably benign Het
Sufu G A 19: 46,454,720 probably benign Het
Tbx2 A G 11: 85,834,766 E181G probably damaging Het
Thumpd2 A G 17: 81,055,888 V50A probably damaging Het
Tmem56 A G 3: 121,207,291 V231A probably benign Het
Ttn C A 2: 76,743,245 R17441L probably damaging Het
Usp34 A G 11: 23,384,477 Y1157C probably damaging Het
Vmn1r9 T C 6: 57,071,537 V199A probably damaging Het
Vmn2r6 A G 3: 64,538,273 F677S probably damaging Het
Vmn2r84 C T 10: 130,389,139 A501T probably benign Het
Wapl C T 14: 34,724,769 P605S probably damaging Het
Zfp598 A G 17: 24,679,649 N474S probably benign Het
Zfyve26 A G 12: 79,274,920 L975P probably damaging Het
Zp3r C T 1: 130,591,444 G255D probably damaging Het
Other mutations in Sall2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01587:Sall2 APN 14 52314571 missense probably damaging 1.00
IGL02152:Sall2 APN 14 52315514 missense probably damaging 1.00
IGL02318:Sall2 APN 14 52315565 missense probably damaging 1.00
IGL02933:Sall2 APN 14 52313027 missense probably benign 0.00
IGL03165:Sall2 APN 14 52314168 missense probably damaging 1.00
R1079:Sall2 UTSW 14 52313203 missense probably benign 0.13
R1674:Sall2 UTSW 14 52313836 missense probably damaging 1.00
R1840:Sall2 UTSW 14 52313725 missense probably damaging 1.00
R1989:Sall2 UTSW 14 52314439 missense probably damaging 1.00
R2339:Sall2 UTSW 14 52313356 missense probably damaging 1.00
R3407:Sall2 UTSW 14 52328104 missense probably benign 0.03
R3870:Sall2 UTSW 14 52313994 missense probably damaging 1.00
R3895:Sall2 UTSW 14 52314047 missense probably damaging 0.99
R4059:Sall2 UTSW 14 52314571 missense probably damaging 1.00
R4272:Sall2 UTSW 14 52313803 missense probably damaging 1.00
R4273:Sall2 UTSW 14 52313803 missense probably damaging 1.00
R4275:Sall2 UTSW 14 52313803 missense probably damaging 1.00
R4289:Sall2 UTSW 14 52313803 missense probably damaging 1.00
R4503:Sall2 UTSW 14 52313459 missense probably benign
R4592:Sall2 UTSW 14 52313803 missense probably damaging 1.00
R4611:Sall2 UTSW 14 52313753 missense probably damaging 1.00
R4615:Sall2 UTSW 14 52312750 missense probably benign 0.20
R4640:Sall2 UTSW 14 52315159 missense probably damaging 0.99
R4693:Sall2 UTSW 14 52314478 missense probably damaging 1.00
R4921:Sall2 UTSW 14 52315393 missense possibly damaging 0.93
R5007:Sall2 UTSW 14 52314493 missense probably damaging 1.00
R5015:Sall2 UTSW 14 52315655 missense possibly damaging 0.92
R5079:Sall2 UTSW 14 52314754 missense probably damaging 1.00
R5419:Sall2 UTSW 14 52313129 missense probably damaging 1.00
R5849:Sall2 UTSW 14 52314247 missense probably benign 0.13
R6229:Sall2 UTSW 14 52313191 missense probably benign
R6397:Sall2 UTSW 14 52315153 missense probably damaging 1.00
R6422:Sall2 UTSW 14 52312724 makesense probably null
R6456:Sall2 UTSW 14 52313593 missense probably damaging 1.00
R6456:Sall2 UTSW 14 52313594 nonsense probably null
R6786:Sall2 UTSW 14 52314621 missense probably damaging 1.00
R7293:Sall2 UTSW 14 52314411 nonsense probably null
R7496:Sall2 UTSW 14 52315561 missense possibly damaging 0.63
R7792:Sall2 UTSW 14 52316064 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTTCAGAAAGTGCGGAACCC -3'
(R):5'- AGTAGCAGACAGTGGCTCAGCAAC -3'

Sequencing Primer
(F):5'- AAGTGCGGAACCCCCATTG -3'
(R):5'- AGTTGGGCACTGCTTACTAATC -3'
Posted On2014-02-18