Mutagenetix > Incidental Mutation

Incidental Mutation 'R1295:Rnf19a'

158090

Institutional Source

Beutler Lab

Gene Symbol

Rnf19a

Ensembl Gene

ENSMUSG00000022280

Gene Name

ring finger protein 19A

Synonyms

XY body protein, Dorfin, Rnf19, XYbp

MMRRC Submission

039361-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.569) question?

Stock #

R1295 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

36239933-36283147 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 36244101 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 604 (Y604*)

Ref Sequence

ENSEMBL: ENSMUSP00000022890 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022890] [ENSMUST00000228358]

AlphaFold

P50636

Predicted Effect

probably null
Transcript: ENSMUST00000022890
AA Change: Y604*

SMART Domains

Protein: ENSMUSP00000022890
Gene: ENSMUSG00000022280
AA Change: Y604*

Domain	Start	End	E-Value	Type
low complexity region	40	56	N/A	INTRINSIC
low complexity region	72	82	N/A	INTRINSIC
RING	132	179	5.56e-3	SMART
IBR	199	264	1.5e-24	SMART
IBR	283	347	1.87e-2	SMART
transmembrane domain	373	395	N/A	INTRINSIC
transmembrane domain	416	438	N/A	INTRINSIC
low complexity region	502	520	N/A	INTRINSIC
low complexity region	664	682	N/A	INTRINSIC
low complexity region	723	734	N/A	INTRINSIC
low complexity region	775	787	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185150

Predicted Effect

probably benign
Transcript: ENSMUST00000228358

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 98.7%
3x: 97.4%
10x: 93.1%
20x: 82.0%

Validation Efficiency

98% (81/83)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ring between ring fingers (RBR) protein family, and the encoded protein contains two RING-finger motifs and an in between RING fingers motif. This protein is an E3 ubiquitin ligase that is localized to Lewy bodies, and ubiquitylates synphilin-1, which is an interacting protein of alpha synuclein in neurons. The encoded protein may be involved in amyotrophic lateral sclerosis and Parkinson's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ackr2	A	G	9: 121,908,717	S53G	possibly damaging	Het
Adgrb1	T	A	15: 74,550,039	L886Q	probably damaging	Het
Adprhl1	G	A	8: 13,248,624	T102M	probably damaging	Het
Akap6	A	C	12: 52,887,029	K435Q	probably damaging	Het
Aldh7a1	T	C	18: 56,546,950		probably null	Het
Amfr	T	C	8: 93,974,804	R507G	probably benign	Het
Ap1m1	T	A	8: 72,251,875		probably null	Het
Arhgap29	A	G	3: 121,992,395	H275R	probably benign	Het
Arhgef17	C	A	7: 100,881,269	E428*	probably null	Het
Atm	A	T	9: 53,456,530	V2431E	probably damaging	Het
Atn1	G	T	6: 124,747,787	P161Q	unknown	Het
Atp13a2	T	C	4: 140,993,802	S99P	probably damaging	Het
Ccar1	C	A	10: 62,783,882		probably null	Het
Cdk18	T	C	1: 132,119,960		probably benign	Het
Cep85	A	G	4: 134,167,400	W32R	probably damaging	Het
Col5a3	A	G	9: 20,808,418	F215S	unknown	Het
Decr1	T	C	4: 15,919,207	N312S	possibly damaging	Het
Diaph3	A	T	14: 87,007,399	W178R	probably damaging	Het
Dync2h1	A	G	9: 7,075,752		probably benign	Het
Ehd3	C	A	17: 73,828,186	D352E	probably damaging	Het
Enpp6	T	G	8: 47,065,500	I221S	probably benign	Het
Fam186a	T	C	15: 99,939,789		probably benign	Het
Gm5435	G	T	12: 82,495,784		noncoding transcript	Het
Gm6990	T	A	19: 56,755,334		noncoding transcript	Het
Gpr22	A	C	12: 31,709,514	I203S	probably benign	Het
Gpr61	A	G	3: 108,150,481	V288A	possibly damaging	Het
Grik3	G	A	4: 125,704,564		probably benign	Het
Gstcd	T	C	3: 133,005,628	N431D	probably damaging	Het
Haao	T	A	17: 83,838,838	Q69L	probably benign	Het
Hist1h1b	T	C	13: 21,779,999	S186G	probably benign	Het
Ift140	G	T	17: 25,088,933		probably null	Het
Ikbke	A	G	1: 131,270,226	V381A	probably benign	Het
Ing1	A	C	8: 11,561,501	I38L	probably benign	Het
Ing1	T	A	8: 11,561,502	I38N	probably damaging	Het
Itga4	A	G	2: 79,322,689	M907V	possibly damaging	Het
Kcnk12	C	T	17: 87,746,373	G287D	probably damaging	Het
Kmt2e	A	C	5: 23,502,404	H1655P	probably damaging	Het
Mbtd1	A	G	11: 93,910,359	Y122C	probably damaging	Het
Mslnl	T	C	17: 25,743,240	L204P	probably damaging	Het
Muc6	T	C	7: 141,651,879	E112G	probably benign	Het
Nav3	T	A	10: 109,692,102	D2240V	probably damaging	Het
Ndufaf3	T	C	9: 108,566,693	T9A	probably damaging	Het
Numb	C	A	12: 83,796,161		probably benign	Het
Prodh2	T	C	7: 30,494,089	V79A	probably damaging	Het
Psmb2	A	G	4: 126,687,032	Y73C	probably damaging	Het
Rmnd5a	G	A	6: 71,398,455	L80F	probably benign	Het
Ros1	T	A	10: 52,087,932	E1744V	possibly damaging	Het
Rpusd2	T	C	2: 119,036,927	F219L	probably benign	Het
Sall2	T	C	14: 52,313,725	N671S	probably damaging	Het
Sele	T	A	1: 164,050,810	S239R	probably damaging	Het
Serpina3b	T	C	12: 104,130,879	F140L	probably damaging	Het
Stxbp1	A	T	2: 32,794,636	S594T	probably benign	Het
Sufu	G	A	19: 46,454,720		probably benign	Het
Tbx2	A	G	11: 85,834,766	E181G	probably damaging	Het
Thumpd2	A	G	17: 81,055,888	V50A	probably damaging	Het
Tmem56	A	G	3: 121,207,291	V231A	probably benign	Het
Ttn	C	A	2: 76,743,245	R17441L	probably damaging	Het
Usp34	A	G	11: 23,384,477	Y1157C	probably damaging	Het
Vmn1r9	T	C	6: 57,071,537	V199A	probably damaging	Het
Vmn2r6	A	G	3: 64,538,273	F677S	probably damaging	Het
Vmn2r84	C	T	10: 130,389,139	A501T	probably benign	Het
Wapl	C	T	14: 34,724,769	P605S	probably damaging	Het
Zfp598	A	G	17: 24,679,649	N474S	probably benign	Het
Zfyve26	A	G	12: 79,274,920	L975P	probably damaging	Het
Zp3r	C	T	1: 130,591,444	G255D	probably damaging	Het

Other mutations in Rnf19a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00158:Rnf19a	APN	15	36265802	missense	probably damaging	0.98
Cycle	UTSW	15	36253304	intron	probably benign
Tolkien	UTSW	15	36265306	missense	possibly damaging	0.80
Wagner	UTSW	15	36244196	missense	probably benign	0.05
R0245:Rnf19a	UTSW	15	36253032	missense	probably damaging	1.00
R0583:Rnf19a	UTSW	15	36253005	missense	probably damaging	1.00
R1528:Rnf19a	UTSW	15	36265655	missense	possibly damaging	0.75
R1710:Rnf19a	UTSW	15	36244207	missense	probably damaging	1.00
R1835:Rnf19a	UTSW	15	36265925	missense	probably benign
R2005:Rnf19a	UTSW	15	36241770	missense	possibly damaging	0.52
R2110:Rnf19a	UTSW	15	36254519	missense	possibly damaging	0.79
R3118:Rnf19a	UTSW	15	36241899	nonsense	probably null
R3776:Rnf19a	UTSW	15	36265912	missense	probably benign	0.03
R4005:Rnf19a	UTSW	15	36245628	missense	probably damaging	0.98
R5184:Rnf19a	UTSW	15	36244196	missense	probably benign	0.05
R5297:Rnf19a	UTSW	15	36247778	missense	probably damaging	1.00
R5386:Rnf19a	UTSW	15	36242039	missense	probably benign	0.01
R5647:Rnf19a	UTSW	15	36265963	start gained	probably benign
R6451:Rnf19a	UTSW	15	36253059	missense	possibly damaging	0.64
R7003:Rnf19a	UTSW	15	36254504	nonsense	probably null
R7304:Rnf19a	UTSW	15	36254452	missense	probably damaging	0.98
R7893:Rnf19a	UTSW	15	36241668	missense	possibly damaging	0.95
R8808:Rnf19a	UTSW	15	36241875	missense	probably benign	0.00
R8864:Rnf19a	UTSW	15	36265306	missense	possibly damaging	0.80
R8940:Rnf19a	UTSW	15	36260138	missense	probably damaging	1.00
R9063:Rnf19a	UTSW	15	36265469	nonsense	probably null
R9093:Rnf19a	UTSW	15	36253304	intron	probably benign
R9135:Rnf19a	UTSW	15	36253164	critical splice acceptor site	probably null
R9525:Rnf19a	UTSW	15	36247229	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGCCATCAGCATTTCCTACCTCAG -3'
(R):5'- TGGGAACCGAAGAGTTGCAGTGTC -3'

Sequencing Primer
(F):5'- AGGACATTTTTCATCATTCAGCCTG -3'
(R):5'- GAGTTGCAGTGTCTAACACTTC -3'

Posted On

2014-02-18