Incidental Mutation 'R1295:Ehd3'
ID158096
Institutional Source Beutler Lab
Gene Symbol Ehd3
Ensembl Gene ENSMUSG00000024065
Gene NameEH-domain containing 3
SynonymsEhd2
MMRRC Submission 039361-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1295 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location73804841-73832093 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 73828186 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 352 (D352E)
Ref Sequence ENSEMBL: ENSMUSP00000024860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024860]
Predicted Effect probably damaging
Transcript: ENSMUST00000024860
AA Change: D352E

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000024860
Gene: ENSMUSG00000024065
AA Change: D352E

DomainStartEndE-ValueType
Pfam:EHD_N 24 56 1.6e-21 PFAM
Pfam:MMR_HSR1 60 220 1.7e-8 PFAM
Pfam:Dynamin_N 61 221 1.3e-12 PFAM
low complexity region 420 433 N/A INTRINSIC
EH 438 531 1.95e-45 SMART
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.4%
  • 10x: 93.1%
  • 20x: 82.0%
Validation Efficiency 98% (81/83)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are healthy and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr2 A G 9: 121,908,717 S53G possibly damaging Het
Adgrb1 T A 15: 74,550,039 L886Q probably damaging Het
Adprhl1 G A 8: 13,248,624 T102M probably damaging Het
Akap6 A C 12: 52,887,029 K435Q probably damaging Het
Aldh7a1 T C 18: 56,546,950 probably null Het
Amfr T C 8: 93,974,804 R507G probably benign Het
Ap1m1 T A 8: 72,251,875 probably null Het
Arhgap29 A G 3: 121,992,395 H275R probably benign Het
Arhgef17 C A 7: 100,881,269 E428* probably null Het
Atm A T 9: 53,456,530 V2431E probably damaging Het
Atn1 G T 6: 124,747,787 P161Q unknown Het
Atp13a2 T C 4: 140,993,802 S99P probably damaging Het
Ccar1 C A 10: 62,783,882 probably null Het
Cdk18 T C 1: 132,119,960 probably benign Het
Cep85 A G 4: 134,167,400 W32R probably damaging Het
Col5a3 A G 9: 20,808,418 F215S unknown Het
Decr1 T C 4: 15,919,207 N312S possibly damaging Het
Diaph3 A T 14: 87,007,399 W178R probably damaging Het
Dync2h1 A G 9: 7,075,752 probably benign Het
Enpp6 T G 8: 47,065,500 I221S probably benign Het
Fam186a T C 15: 99,939,789 probably benign Het
Gm5435 G T 12: 82,495,784 noncoding transcript Het
Gm6990 T A 19: 56,755,334 noncoding transcript Het
Gpr22 A C 12: 31,709,514 I203S probably benign Het
Gpr61 A G 3: 108,150,481 V288A possibly damaging Het
Grik3 G A 4: 125,704,564 probably benign Het
Gstcd T C 3: 133,005,628 N431D probably damaging Het
Haao T A 17: 83,838,838 Q69L probably benign Het
Hist1h1b T C 13: 21,779,999 S186G probably benign Het
Ift140 G T 17: 25,088,933 probably null Het
Ikbke A G 1: 131,270,226 V381A probably benign Het
Ing1 A C 8: 11,561,501 I38L probably benign Het
Ing1 T A 8: 11,561,502 I38N probably damaging Het
Itga4 A G 2: 79,322,689 M907V possibly damaging Het
Kcnk12 C T 17: 87,746,373 G287D probably damaging Het
Kmt2e A C 5: 23,502,404 H1655P probably damaging Het
Mbtd1 A G 11: 93,910,359 Y122C probably damaging Het
Mslnl T C 17: 25,743,240 L204P probably damaging Het
Muc6 T C 7: 141,651,879 E112G probably benign Het
Nav3 T A 10: 109,692,102 D2240V probably damaging Het
Ndufaf3 T C 9: 108,566,693 T9A probably damaging Het
Numb C A 12: 83,796,161 probably benign Het
Prodh2 T C 7: 30,494,089 V79A probably damaging Het
Psmb2 A G 4: 126,687,032 Y73C probably damaging Het
Rmnd5a G A 6: 71,398,455 L80F probably benign Het
Rnf19a G T 15: 36,244,101 Y604* probably null Het
Ros1 T A 10: 52,087,932 E1744V possibly damaging Het
Rpusd2 T C 2: 119,036,927 F219L probably benign Het
Sall2 T C 14: 52,313,725 N671S probably damaging Het
Sele T A 1: 164,050,810 S239R probably damaging Het
Serpina3b T C 12: 104,130,879 F140L probably damaging Het
Stxbp1 A T 2: 32,794,636 S594T probably benign Het
Sufu G A 19: 46,454,720 probably benign Het
Tbx2 A G 11: 85,834,766 E181G probably damaging Het
Thumpd2 A G 17: 81,055,888 V50A probably damaging Het
Tmem56 A G 3: 121,207,291 V231A probably benign Het
Ttn C A 2: 76,743,245 R17441L probably damaging Het
Usp34 A G 11: 23,384,477 Y1157C probably damaging Het
Vmn1r9 T C 6: 57,071,537 V199A probably damaging Het
Vmn2r6 A G 3: 64,538,273 F677S probably damaging Het
Vmn2r84 C T 10: 130,389,139 A501T probably benign Het
Wapl C T 14: 34,724,769 P605S probably damaging Het
Zfp598 A G 17: 24,679,649 N474S probably benign Het
Zfyve26 A G 12: 79,274,920 L975P probably damaging Het
Zp3r C T 1: 130,591,444 G255D probably damaging Het
Other mutations in Ehd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01010:Ehd3 APN 17 73827489 missense probably damaging 0.99
IGL01400:Ehd3 APN 17 73828094 missense probably benign 0.06
IGL01557:Ehd3 APN 17 73805280 missense probably benign
IGL02214:Ehd3 APN 17 73820546 missense probably damaging 1.00
IGL03053:Ehd3 APN 17 73805442 missense probably damaging 0.97
IGL02796:Ehd3 UTSW 17 73816401 missense probably damaging 1.00
R0468:Ehd3 UTSW 17 73805379 missense probably damaging 1.00
R0557:Ehd3 UTSW 17 73829933 missense probably benign 0.00
R1029:Ehd3 UTSW 17 73816326 missense probably benign 0.00
R1386:Ehd3 UTSW 17 73820543 missense probably damaging 1.00
R1796:Ehd3 UTSW 17 73830359 missense probably damaging 1.00
R3821:Ehd3 UTSW 17 73827395 missense probably benign 0.01
R4873:Ehd3 UTSW 17 73805304 missense probably damaging 1.00
R4875:Ehd3 UTSW 17 73805304 missense probably damaging 1.00
R5104:Ehd3 UTSW 17 73827447 missense probably benign 0.44
R5244:Ehd3 UTSW 17 73830000 missense probably benign
R5283:Ehd3 UTSW 17 73820503 missense probably benign
R5339:Ehd3 UTSW 17 73828207 missense possibly damaging 0.63
R5966:Ehd3 UTSW 17 73827361 missense probably damaging 1.00
R5966:Ehd3 UTSW 17 73827366 missense probably damaging 1.00
R6255:Ehd3 UTSW 17 73805413 missense probably benign 0.17
R6906:Ehd3 UTSW 17 73830338 missense probably damaging 1.00
R7113:Ehd3 UTSW 17 73830184 missense probably benign 0.17
R7368:Ehd3 UTSW 17 73827462 missense possibly damaging 0.72
R7410:Ehd3 UTSW 17 73805433 missense probably benign 0.04
R7891:Ehd3 UTSW 17 73816392 missense probably benign 0.19
Z1176:Ehd3 UTSW 17 73805285 missense probably benign 0.01
Z1177:Ehd3 UTSW 17 73830105 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACACCTTAGTGTTCAGAAGCTGCC -3'
(R):5'- TCTGTGCCTTTGGGGACAACTG -3'

Sequencing Primer
(F):5'- GTTCAGAAGCTGCCACTGTC -3'
(R):5'- GGACAACTGGGCTGTTTCTC -3'
Posted On2014-02-18