Incidental Mutation 'R1295:Sufu'
ID158101
Institutional Source Beutler Lab
Gene Symbol Sufu
Ensembl Gene ENSMUSG00000025231
Gene NameSUFU negative regulator of hedgehog signaling
Synonymsb2b273Clo, Su(Fu), 2810026F04Rik
MMRRC Submission 039361-MU
Accession Numbers

Ncbi RefSeq: NM_015752.2; NM_001025391.1; MGI:1345643

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1295 (G1)
Quality Score173
Status Validated
Chromosome19
Chromosomal Location46396896-46488804 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 46454720 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112653 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039922] [ENSMUST00000111867] [ENSMUST00000118440] [ENSMUST00000120778]
Predicted Effect probably benign
Transcript: ENSMUST00000039922
SMART Domains Protein: ENSMUSP00000049109
Gene: ENSMUSG00000025231

DomainStartEndE-ValueType
low complexity region 9 34 N/A INTRINSIC
Pfam:SUFU 63 242 2.9e-38 PFAM
Pfam:SUFU_C 252 473 1.6e-99 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111867
SMART Domains Protein: ENSMUSP00000107498
Gene: ENSMUSG00000025231

DomainStartEndE-ValueType
low complexity region 9 34 N/A INTRINSIC
Pfam:SUFU 64 241 4.9e-54 PFAM
Pfam:SUFU_C 254 474 2.3e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118440
SMART Domains Protein: ENSMUSP00000113073
Gene: ENSMUSG00000025231

DomainStartEndE-ValueType
low complexity region 9 34 N/A INTRINSIC
Pfam:SUFU 63 242 3.2e-38 PFAM
Pfam:SUFU_C 252 436 9.8e-78 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120778
SMART Domains Protein: ENSMUSP00000112653
Gene: ENSMUSG00000025231

DomainStartEndE-ValueType
low complexity region 9 34 N/A INTRINSIC
Pfam:SUFU 59 197 4.8e-30 PFAM
Pfam:SUFU_C 208 297 2e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123252
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.4%
  • 10x: 93.1%
  • 20x: 82.0%
Validation Efficiency 98% (81/83)
MGI Phenotype Strain: 3512046; 3619046
Lethality: E9-E11
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Hedgehog signaling pathway plays an important role in early human development. The pathway is a signaling cascade that plays a role in pattern formation and cellular proliferation during development. This gene encodes a negative regulator of the hedgehog signaling pathway. Defects in this gene are a cause of medulloblastoma. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
PHENOTYPE: Targeted disruption results in mid-gestation lethality, embryonic growth retardation, incomplete embryo turning, open neural tube, abnormal somite development, left-right asymmetry defects resulting in cardiac looping, and hemorrhage in the diencephalon. [provided by MGI curators]
Allele List at MGI

All alleles(32) : Targeted(7) Gene trapped(25)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr2 A G 9: 121,908,717 S53G possibly damaging Het
Adgrb1 T A 15: 74,550,039 L886Q probably damaging Het
Adprhl1 G A 8: 13,248,624 T102M probably damaging Het
Akap6 A C 12: 52,887,029 K435Q probably damaging Het
Aldh7a1 T C 18: 56,546,950 probably null Het
Amfr T C 8: 93,974,804 R507G probably benign Het
Ap1m1 T A 8: 72,251,875 probably null Het
Arhgap29 A G 3: 121,992,395 H275R probably benign Het
Arhgef17 C A 7: 100,881,269 E428* probably null Het
Atm A T 9: 53,456,530 V2431E probably damaging Het
Atn1 G T 6: 124,747,787 P161Q unknown Het
Atp13a2 T C 4: 140,993,802 S99P probably damaging Het
Ccar1 C A 10: 62,783,882 probably null Het
Cdk18 T C 1: 132,119,960 probably benign Het
Cep85 A G 4: 134,167,400 W32R probably damaging Het
Col5a3 A G 9: 20,808,418 F215S unknown Het
Decr1 T C 4: 15,919,207 N312S possibly damaging Het
Diaph3 A T 14: 87,007,399 W178R probably damaging Het
Dync2h1 A G 9: 7,075,752 probably benign Het
Ehd3 C A 17: 73,828,186 D352E probably damaging Het
Enpp6 T G 8: 47,065,500 I221S probably benign Het
Fam186a T C 15: 99,939,789 probably benign Het
Gm5435 G T 12: 82,495,784 noncoding transcript Het
Gm6990 T A 19: 56,755,334 noncoding transcript Het
Gpr22 A C 12: 31,709,514 I203S probably benign Het
Gpr61 A G 3: 108,150,481 V288A possibly damaging Het
Grik3 G A 4: 125,704,564 probably benign Het
Gstcd T C 3: 133,005,628 N431D probably damaging Het
Haao T A 17: 83,838,838 Q69L probably benign Het
Hist1h1b T C 13: 21,779,999 S186G probably benign Het
Ift140 G T 17: 25,088,933 probably null Het
Ikbke A G 1: 131,270,226 V381A probably benign Het
Ing1 A C 8: 11,561,501 I38L probably benign Het
Ing1 T A 8: 11,561,502 I38N probably damaging Het
Itga4 A G 2: 79,322,689 M907V possibly damaging Het
Kcnk12 C T 17: 87,746,373 G287D probably damaging Het
Kmt2e A C 5: 23,502,404 H1655P probably damaging Het
Mbtd1 A G 11: 93,910,359 Y122C probably damaging Het
Mslnl T C 17: 25,743,240 L204P probably damaging Het
Muc6 T C 7: 141,651,879 E112G probably benign Het
Nav3 T A 10: 109,692,102 D2240V probably damaging Het
Ndufaf3 T C 9: 108,566,693 T9A probably damaging Het
Numb C A 12: 83,796,161 probably benign Het
Prodh2 T C 7: 30,494,089 V79A probably damaging Het
Psmb2 A G 4: 126,687,032 Y73C probably damaging Het
Rmnd5a G A 6: 71,398,455 L80F probably benign Het
Rnf19a G T 15: 36,244,101 Y604* probably null Het
Ros1 T A 10: 52,087,932 E1744V possibly damaging Het
Rpusd2 T C 2: 119,036,927 F219L probably benign Het
Sall2 T C 14: 52,313,725 N671S probably damaging Het
Sele T A 1: 164,050,810 S239R probably damaging Het
Serpina3b T C 12: 104,130,879 F140L probably damaging Het
Stxbp1 A T 2: 32,794,636 S594T probably benign Het
Tbx2 A G 11: 85,834,766 E181G probably damaging Het
Thumpd2 A G 17: 81,055,888 V50A probably damaging Het
Tmem56 A G 3: 121,207,291 V231A probably benign Het
Ttn C A 2: 76,743,245 R17441L probably damaging Het
Usp34 A G 11: 23,384,477 Y1157C probably damaging Het
Vmn1r9 T C 6: 57,071,537 V199A probably damaging Het
Vmn2r6 A G 3: 64,538,273 F677S probably damaging Het
Vmn2r84 C T 10: 130,389,139 A501T probably benign Het
Wapl C T 14: 34,724,769 P605S probably damaging Het
Zfp598 A G 17: 24,679,649 N474S probably benign Het
Zfyve26 A G 12: 79,274,920 L975P probably damaging Het
Zp3r C T 1: 130,591,444 G255D probably damaging Het
Other mutations in Sufu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01322:Sufu APN 19 46450943 missense probably damaging 1.00
IGL01613:Sufu APN 19 46475620 missense probably damaging 1.00
IGL01652:Sufu APN 19 46475620 missense probably damaging 1.00
IGL02420:Sufu APN 19 46425042 missense probably damaging 1.00
IGL02501:Sufu APN 19 46450910 missense probably benign 0.04
IGL02984:Sufu UTSW 19 46473599 missense probably benign
P0018:Sufu UTSW 19 46475494 splice site probably benign
R0172:Sufu UTSW 19 46397124 missense possibly damaging 0.86
R0280:Sufu UTSW 19 46450673 splice site probably benign
R1175:Sufu UTSW 19 46401264 splice site probably null
R1296:Sufu UTSW 19 46454720 splice site probably benign
R1420:Sufu UTSW 19 46397184 missense probably benign 0.36
R1846:Sufu UTSW 19 46450947 missense possibly damaging 0.47
R2061:Sufu UTSW 19 46397212 missense probably damaging 1.00
R4082:Sufu UTSW 19 46425102 missense probably damaging 0.99
R4151:Sufu UTSW 19 46449972 critical splice donor site probably null
R4744:Sufu UTSW 19 46483630 missense possibly damaging 0.78
R4751:Sufu UTSW 19 46483649 missense probably benign 0.01
R4959:Sufu UTSW 19 46475552 missense possibly damaging 0.58
R4973:Sufu UTSW 19 46475552 missense possibly damaging 0.58
R5221:Sufu UTSW 19 46450965 critical splice donor site probably null
R5890:Sufu UTSW 19 46454733 critical splice acceptor site probably null
R6030:Sufu UTSW 19 46475539 missense probably damaging 0.99
R6030:Sufu UTSW 19 46475539 missense probably damaging 0.99
R6226:Sufu UTSW 19 46473654 missense probably damaging 1.00
R6233:Sufu UTSW 19 46475632 missense probably damaging 1.00
R6811:Sufu UTSW 19 46449878 missense probably damaging 1.00
R6923:Sufu UTSW 19 46450966 splice site probably null
R7095:Sufu UTSW 19 46475588 missense probably damaging 1.00
R7223:Sufu UTSW 19 46453277 missense possibly damaging 0.82
R7390:Sufu UTSW 19 46450669 splice site probably null
R8190:Sufu UTSW 19 46401197 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAAGTTGCTGGTCGTGCCTTCTCC -3'
(R):5'- AAAACACCGTCCTTTTGTCCTAGCC -3'

Sequencing Primer
(F):5'- CCTTTATTGTGTGTAGCCCAC -3'
(R):5'- TTTGTCCTAGCCCCAGAACAC -3'
Posted On2014-02-18