Incidental Mutation 'R1296:Grik3'
ID158112
Institutional Source Beutler Lab
Gene Symbol Grik3
Ensembl Gene ENSMUSG00000001985
Gene Nameglutamate receptor, ionotropic, kainate 3
SynonymsGlur7, Glur-7
MMRRC Submission 039362-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.270) question?
Stock #R1296 (G1)
Quality Score198
Status Validated
Chromosome4
Chromosomal Location125490700-125714173 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 125704564 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000030676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030676]
Predicted Effect probably benign
Transcript: ENSMUST00000030676
SMART Domains Protein: ENSMUSP00000030676
Gene: ENSMUSG00000001985

DomainStartEndE-ValueType
Pfam:ANF_receptor 55 398 7.8e-72 PFAM
PBPe 435 802 4.38e-133 SMART
Lig_chan-Glu_bd 445 509 5.77e-34 SMART
transmembrane domain 823 845 N/A INTRINSIC
Meta Mutation Damage Score 0.1228 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.5%
  • 20x: 87.1%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. This gene product belongs to the kainate family of glutamate receptors, which are composed of four subunits and function as ligand-activated ion channels. Transcript variants encoding different isoforms have been described for this gene, however, their full-length nature is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit significantly reduced short- and long-term synaptic potentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam29 G A 8: 55,871,719 Q567* probably null Het
Apol11a T C 15: 77,511,019 probably benign Het
Arhgap29 A G 3: 121,992,395 H275R probably benign Het
Arhgef17 C A 7: 100,881,269 E428* probably null Het
Atm A T 9: 53,456,530 V2431E probably damaging Het
Atn1 G T 6: 124,747,787 P161Q unknown Het
Atp13a2 T C 4: 140,993,802 S99P probably damaging Het
Atp8a1 A T 5: 67,622,706 probably benign Het
Cbwd1 A T 19: 24,942,675 probably benign Het
Cdk18 T C 1: 132,119,960 probably benign Het
Cep85 A G 4: 134,167,400 W32R probably damaging Het
Cntn4 G T 6: 106,509,402 G264C probably damaging Het
Col6a4 A G 9: 106,062,853 S1293P possibly damaging Het
Col6a6 T C 9: 105,781,091 K641E probably damaging Het
Dmd A T X: 83,878,520 K1465N probably damaging Het
Dus2 T C 8: 106,053,043 V403A possibly damaging Het
Frs2 C T 10: 117,081,074 C5Y probably benign Het
Gm5174 A G 10: 86,657,002 noncoding transcript Het
Gm6990 T A 19: 56,755,334 noncoding transcript Het
Gpr61 A G 3: 108,150,481 V288A possibly damaging Het
Haao T A 17: 83,838,838 Q69L probably benign Het
Ints6 T C 14: 62,704,903 probably benign Het
Ints8 T C 4: 11,221,204 I724V possibly damaging Het
Lrrk2 G A 15: 91,728,920 C749Y probably damaging Het
Map4k1 A G 7: 28,998,452 D471G possibly damaging Het
Mbtd1 A G 11: 93,910,359 Y122C probably damaging Het
Mrfap1 A G 5: 36,796,473 S41P possibly damaging Het
Mrm2 T C 5: 140,328,553 T176A probably benign Het
Mslnl T C 17: 25,743,240 L204P probably damaging Het
Muc6 T C 7: 141,651,879 E112G probably benign Het
Nfyb A G 10: 82,750,831 probably benign Het
Nlgn3 T C X: 101,308,916 probably benign Het
Nr3c1 G A 18: 39,486,998 Q79* probably null Het
Nxpe4 C G 9: 48,396,493 T299R probably benign Het
Otud4 C A 8: 79,673,974 H1105N unknown Het
Pcnx2 A G 8: 125,773,833 L1506P probably damaging Het
Prl2c5 T A 13: 13,189,424 H88Q probably damaging Het
Psmb2 A G 4: 126,687,032 Y73C probably damaging Het
Rbl1 A T 2: 157,169,971 V688D probably benign Het
Rhox2g C A X: 37,643,212 probably benign Het
Rmnd5a G A 6: 71,398,455 L80F probably benign Het
Ryr2 T C 13: 11,687,879 probably benign Het
Sele T A 1: 164,050,810 S239R probably damaging Het
Siglecf A T 7: 43,355,920 R435* probably null Het
Slc23a1 C T 18: 35,622,623 V407M possibly damaging Het
Slc6a14 G A X: 21,721,568 V122I probably benign Het
Spdl1 T A 11: 34,813,607 E466D unknown Het
Stau2 A G 1: 16,440,372 F121L probably benign Het
Stxbp1 A T 2: 32,794,636 S594T probably benign Het
Sufu G A 19: 46,454,720 probably benign Het
Tap2 G T 17: 34,211,915 V330L probably benign Het
Tbc1d1 T C 5: 64,264,432 L389P probably damaging Het
Tbx2 A G 11: 85,834,766 E181G probably damaging Het
Tmem56 A G 3: 121,207,291 V231A probably benign Het
Tmprss9 G T 10: 80,890,445 A510S probably benign Het
Tnxb G A 17: 34,671,577 C298Y probably damaging Het
Tril G T 6: 53,818,027 R737S probably damaging Het
Ugt2a3 A T 5: 87,327,146 L413Q probably damaging Het
Vcan A G 13: 89,657,556 I2335T probably damaging Het
Vmn2r28 T C 7: 5,481,545 N552S possibly damaging Het
Zc3h7a C T 16: 11,161,026 R95H probably damaging Het
Zfp598 A G 17: 24,679,649 N474S probably benign Het
Zpld1 T C 16: 55,248,334 D138G probably damaging Het
Other mutations in Grik3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01135:Grik3 APN 4 125632415 missense probably benign
IGL01534:Grik3 APN 4 125686190 missense probably damaging 1.00
IGL01538:Grik3 APN 4 125694036 missense possibly damaging 0.90
IGL02276:Grik3 APN 4 125623502 missense possibly damaging 0.86
IGL02323:Grik3 APN 4 125685990 splice site probably benign
IGL02475:Grik3 APN 4 125650517 missense probably benign
IGL03198:Grik3 APN 4 125659762 missense probably benign 0.25
IGL03307:Grik3 APN 4 125641554 missense possibly damaging 0.91
R0054:Grik3 UTSW 4 125623575 missense probably damaging 1.00
R0054:Grik3 UTSW 4 125623575 missense probably damaging 1.00
R0116:Grik3 UTSW 4 125670556 missense probably benign 0.01
R0208:Grik3 UTSW 4 125686165 missense probably damaging 1.00
R0497:Grik3 UTSW 4 125623510 missense possibly damaging 0.82
R1295:Grik3 UTSW 4 125704564 splice site probably benign
R1515:Grik3 UTSW 4 125670728 missense probably benign 0.37
R1559:Grik3 UTSW 4 125707997 missense probably benign 0.16
R1617:Grik3 UTSW 4 125691192 missense probably benign
R1848:Grik3 UTSW 4 125694138 missense probably damaging 1.00
R2903:Grik3 UTSW 4 125670644 missense probably damaging 1.00
R3440:Grik3 UTSW 4 125693970 missense probably damaging 1.00
R3440:Grik3 UTSW 4 125693971 missense probably damaging 1.00
R3442:Grik3 UTSW 4 125693970 missense probably damaging 1.00
R3442:Grik3 UTSW 4 125693971 missense probably damaging 1.00
R3842:Grik3 UTSW 4 125693954 splice site probably benign
R4649:Grik3 UTSW 4 125650485 missense probably damaging 1.00
R4841:Grik3 UTSW 4 125691176 missense probably damaging 1.00
R4842:Grik3 UTSW 4 125691176 missense probably damaging 1.00
R5093:Grik3 UTSW 4 125670589 missense probably benign
R5318:Grik3 UTSW 4 125694136 missense probably damaging 0.96
R5549:Grik3 UTSW 4 125686045 missense possibly damaging 0.95
R6221:Grik3 UTSW 4 125705123 missense probably damaging 0.99
R6226:Grik3 UTSW 4 125659789 missense probably benign 0.04
R6306:Grik3 UTSW 4 125632412 missense probably benign 0.01
R6672:Grik3 UTSW 4 125623516 missense probably benign 0.08
R6682:Grik3 UTSW 4 125650466 missense probably damaging 1.00
R6783:Grik3 UTSW 4 125632300 missense probably benign 0.01
R7390:Grik3 UTSW 4 125649739 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAGCCATGCTGAGTGACTGAAG -3'
(R):5'- GATGACCAAGCCAGGATTGTGTCTC -3'

Sequencing Primer
(F):5'- GATCTCCACCTTTGAGAAGATGTG -3'
(R):5'- CAGGATTGTGTCTCCATCCC -3'
Posted On2014-02-18