Incidental Mutation 'R1296:Atn1'
ID158124
Institutional Source Beutler Lab
Gene Symbol Atn1
Ensembl Gene ENSMUSG00000004263
Gene Nameatrophin 1
Synonymsatrophin-1, Drpla, Atr1
MMRRC Submission 039362-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1296 (G1)
Quality Score197
Status Validated
Chromosome6
Chromosomal Location124742544-124756524 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 124747787 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 161 (P161Q)
Ref Sequence ENSEMBL: ENSMUSP00000123560 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088357] [ENSMUST00000129411] [ENSMUST00000146872]
Predicted Effect unknown
Transcript: ENSMUST00000088357
AA Change: P161Q
SMART Domains Protein: ENSMUSP00000085695
Gene: ENSMUSG00000004263
AA Change: P161Q

DomainStartEndE-ValueType
Pfam:Atrophin-1 1 191 7.9e-30 PFAM
low complexity region 209 218 N/A INTRINSIC
low complexity region 231 253 N/A INTRINSIC
low complexity region 256 297 N/A INTRINSIC
low complexity region 301 317 N/A INTRINSIC
low complexity region 351 372 N/A INTRINSIC
low complexity region 378 396 N/A INTRINSIC
Pfam:Atrophin-1 405 1174 4.6e-209 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000129411
AA Change: P161Q
SMART Domains Protein: ENSMUSP00000115407
Gene: ENSMUSG00000107478
AA Change: P161Q

DomainStartEndE-ValueType
Pfam:Atrophin-1 1 164 3.8e-33 PFAM
low complexity region 209 218 N/A INTRINSIC
low complexity region 231 253 N/A INTRINSIC
low complexity region 256 297 N/A INTRINSIC
low complexity region 301 317 N/A INTRINSIC
Pfam:Atrophin-1 327 1175 1.7e-192 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133577
Predicted Effect unknown
Transcript: ENSMUST00000146872
AA Change: P161Q
SMART Domains Protein: ENSMUSP00000123560
Gene: ENSMUSG00000004263
AA Change: P161Q

DomainStartEndE-ValueType
Pfam:Atrophin-1 1 182 2.6e-36 PFAM
Meta Mutation Damage Score 0.1460 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.5%
  • 20x: 87.1%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dentatorubral pallidoluysian atrophy (DRPLA) is a rare neurodegenerative disorder characterized by cerebellar ataxia, myoclonic epilepsy, choreoathetosis, and dementia. The disorder is related to the expansion from 7-35 copies to 49-93 copies of a trinucleotide repeat (CAG/CAA) within this gene. The encoded protein includes a serine repeat and a region of alternating acidic and basic amino acids, as well as the variable glutamine repeat. Alternative splicing results in two transcripts variants that encode the same protein. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous null mice are viable and fertile, however mice expressing a truncated protein lacking the poly-Q repeat and C-terminal peptides display growth retardation, progressive male infertility with small testis and low sperm counts, and consume less food. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam29 G A 8: 55,871,719 Q567* probably null Het
Apol11a T C 15: 77,511,019 probably benign Het
Arhgap29 A G 3: 121,992,395 H275R probably benign Het
Arhgef17 C A 7: 100,881,269 E428* probably null Het
Atm A T 9: 53,456,530 V2431E probably damaging Het
Atp13a2 T C 4: 140,993,802 S99P probably damaging Het
Atp8a1 A T 5: 67,622,706 probably benign Het
Cbwd1 A T 19: 24,942,675 probably benign Het
Cdk18 T C 1: 132,119,960 probably benign Het
Cep85 A G 4: 134,167,400 W32R probably damaging Het
Cntn4 G T 6: 106,509,402 G264C probably damaging Het
Col6a4 A G 9: 106,062,853 S1293P possibly damaging Het
Col6a6 T C 9: 105,781,091 K641E probably damaging Het
Dmd A T X: 83,878,520 K1465N probably damaging Het
Dus2 T C 8: 106,053,043 V403A possibly damaging Het
Frs2 C T 10: 117,081,074 C5Y probably benign Het
Gm5174 A G 10: 86,657,002 noncoding transcript Het
Gm6990 T A 19: 56,755,334 noncoding transcript Het
Gpr61 A G 3: 108,150,481 V288A possibly damaging Het
Grik3 G A 4: 125,704,564 probably benign Het
Haao T A 17: 83,838,838 Q69L probably benign Het
Ints6 T C 14: 62,704,903 probably benign Het
Ints8 T C 4: 11,221,204 I724V possibly damaging Het
Lrrk2 G A 15: 91,728,920 C749Y probably damaging Het
Map4k1 A G 7: 28,998,452 D471G possibly damaging Het
Mbtd1 A G 11: 93,910,359 Y122C probably damaging Het
Mrfap1 A G 5: 36,796,473 S41P possibly damaging Het
Mrm2 T C 5: 140,328,553 T176A probably benign Het
Mslnl T C 17: 25,743,240 L204P probably damaging Het
Muc6 T C 7: 141,651,879 E112G probably benign Het
Nfyb A G 10: 82,750,831 probably benign Het
Nlgn3 T C X: 101,308,916 probably benign Het
Nr3c1 G A 18: 39,486,998 Q79* probably null Het
Nxpe4 C G 9: 48,396,493 T299R probably benign Het
Otud4 C A 8: 79,673,974 H1105N unknown Het
Pcnx2 A G 8: 125,773,833 L1506P probably damaging Het
Prl2c5 T A 13: 13,189,424 H88Q probably damaging Het
Psmb2 A G 4: 126,687,032 Y73C probably damaging Het
Rbl1 A T 2: 157,169,971 V688D probably benign Het
Rhox2g C A X: 37,643,212 probably benign Het
Rmnd5a G A 6: 71,398,455 L80F probably benign Het
Ryr2 T C 13: 11,687,879 probably benign Het
Sele T A 1: 164,050,810 S239R probably damaging Het
Siglecf A T 7: 43,355,920 R435* probably null Het
Slc23a1 C T 18: 35,622,623 V407M possibly damaging Het
Slc6a14 G A X: 21,721,568 V122I probably benign Het
Spdl1 T A 11: 34,813,607 E466D unknown Het
Stau2 A G 1: 16,440,372 F121L probably benign Het
Stxbp1 A T 2: 32,794,636 S594T probably benign Het
Sufu G A 19: 46,454,720 probably benign Het
Tap2 G T 17: 34,211,915 V330L probably benign Het
Tbc1d1 T C 5: 64,264,432 L389P probably damaging Het
Tbx2 A G 11: 85,834,766 E181G probably damaging Het
Tmem56 A G 3: 121,207,291 V231A probably benign Het
Tmprss9 G T 10: 80,890,445 A510S probably benign Het
Tnxb G A 17: 34,671,577 C298Y probably damaging Het
Tril G T 6: 53,818,027 R737S probably damaging Het
Ugt2a3 A T 5: 87,327,146 L413Q probably damaging Het
Vcan A G 13: 89,657,556 I2335T probably damaging Het
Vmn2r28 T C 7: 5,481,545 N552S possibly damaging Het
Zc3h7a C T 16: 11,161,026 R95H probably damaging Het
Zfp598 A G 17: 24,679,649 N474S probably benign Het
Zpld1 T C 16: 55,248,334 D138G probably damaging Het
Other mutations in Atn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Atn1 APN 6 124749276 missense probably damaging 0.96
Janvier UTSW 6 124744956 unclassified probably benign
R0122:Atn1 UTSW 6 124743234 unclassified probably benign
R0227:Atn1 UTSW 6 124746930 unclassified probably benign
R0385:Atn1 UTSW 6 124743371 unclassified probably benign
R0394:Atn1 UTSW 6 124749733 splice site probably benign
R0834:Atn1 UTSW 6 124743225 unclassified probably benign
R1295:Atn1 UTSW 6 124747787 missense unknown
R1865:Atn1 UTSW 6 124745296 unclassified probably benign
R1992:Atn1 UTSW 6 124745328 unclassified probably benign
R2268:Atn1 UTSW 6 124746240 unclassified probably benign
R3826:Atn1 UTSW 6 124746219 unclassified probably benign
R4903:Atn1 UTSW 6 124743257 unclassified probably benign
R5601:Atn1 UTSW 6 124743228 critical splice donor site probably null
R5680:Atn1 UTSW 6 124747815 missense possibly damaging 0.92
R6167:Atn1 UTSW 6 124746737 unclassified probably benign
R6314:Atn1 UTSW 6 124747050 unclassified probably benign
R6427:Atn1 UTSW 6 124746176 unclassified probably benign
R6538:Atn1 UTSW 6 124746549 unclassified probably benign
R6606:Atn1 UTSW 6 124744956 unclassified probably benign
R7240:Atn1 UTSW 6 124747898 missense unknown
Z1177:Atn1 UTSW 6 124745035 missense unknown
Predicted Primers PCR Primer
(F):5'- TAGCATTCCCAGGGTAGAGCTGTG -3'
(R):5'- ACTATTAGGGAGCAGCCGAGATGTG -3'

Sequencing Primer
(F):5'- GGGTGTGTGGGAGGAGC -3'
(R):5'- ATTTTCCCTGACAGCAGGAGC -3'
Posted On2014-02-18