Incidental Mutation 'R1296:Siglecf'
ID158127
Institutional Source Beutler Lab
Gene Symbol Siglecf
Ensembl Gene ENSMUSG00000039013
Gene Namesialic acid binding Ig-like lectin F
SynonymsmSiglec-F, Siglec5
MMRRC Submission 039362-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1296 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location43351341-43359531 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 43355920 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 435 (R435*)
Ref Sequence ENSEMBL: ENSMUSP00000113245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012798] [ENSMUST00000121494] [ENSMUST00000122423] [ENSMUST00000206299]
Predicted Effect probably null
Transcript: ENSMUST00000012798
AA Change: R435*
SMART Domains Protein: ENSMUSP00000012798
Gene: ENSMUSG00000039013
AA Change: R435*

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 25 131 6.07e-3 SMART
IG_like 142 226 4.91e1 SMART
IGc2 256 315 8.7e-13 SMART
transmembrane domain 440 462 N/A INTRINSIC
low complexity region 486 500 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000121494
AA Change: R435*
SMART Domains Protein: ENSMUSP00000112583
Gene: ENSMUSG00000039013
AA Change: R435*

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 25 131 6.07e-3 SMART
IG_like 142 226 4.91e1 SMART
IGc2 256 315 8.7e-13 SMART
Pfam:Ig_2 329 421 2.4e-3 PFAM
transmembrane domain 440 462 N/A INTRINSIC
low complexity region 486 500 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000122423
AA Change: R435*
SMART Domains Protein: ENSMUSP00000113245
Gene: ENSMUSG00000039013
AA Change: R435*

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 25 131 6.07e-3 SMART
IG_like 142 226 4.91e1 SMART
IGc2 256 315 8.7e-13 SMART
Pfam:Ig_2 329 421 5.1e-4 PFAM
transmembrane domain 440 462 N/A INTRINSIC
low complexity region 486 500 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125335
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145867
Predicted Effect probably benign
Transcript: ENSMUST00000206299
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.5%
  • 20x: 87.1%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sialic acid-binding immunoglobulin (Ig)-like lectins, or SIGLECs (e.g., CD33 (MIM 159590)), are a family of type 1 transmembrane proteins each having a unique expression pattern, mostly in hemopoietic cells. SIGLEC8 is a member of the CD33-like subgroup of SIGLECs, which are localized to 19q13.3-q13.4 and have 2 conserved cytoplasmic tyrosine-based motifs: an immunoreceptor tyrosine-based inhibitory motif, or ITIM (see MIM 604964), and a motif homologous to one identified in signaling lymphocyte activation molecule (SLAM; MIM 603492) that mediates an association with SLAM-associated protein (SAP; MIM 300490) (summarized by Foussias et al., 2000 [PubMed 11095983]).[supplied by OMIM, May 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased lung inflammation in response to ovalbumin challenge with increased eosinophils, delayed eosinophil resolution and impaired eosinophil apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam29 G A 8: 55,871,719 Q567* probably null Het
Apol11a T C 15: 77,511,019 probably benign Het
Arhgap29 A G 3: 121,992,395 H275R probably benign Het
Arhgef17 C A 7: 100,881,269 E428* probably null Het
Atm A T 9: 53,456,530 V2431E probably damaging Het
Atn1 G T 6: 124,747,787 P161Q unknown Het
Atp13a2 T C 4: 140,993,802 S99P probably damaging Het
Atp8a1 A T 5: 67,622,706 probably benign Het
Cbwd1 A T 19: 24,942,675 probably benign Het
Cdk18 T C 1: 132,119,960 probably benign Het
Cep85 A G 4: 134,167,400 W32R probably damaging Het
Cntn4 G T 6: 106,509,402 G264C probably damaging Het
Col6a4 A G 9: 106,062,853 S1293P possibly damaging Het
Col6a6 T C 9: 105,781,091 K641E probably damaging Het
Dmd A T X: 83,878,520 K1465N probably damaging Het
Dus2 T C 8: 106,053,043 V403A possibly damaging Het
Frs2 C T 10: 117,081,074 C5Y probably benign Het
Gm5174 A G 10: 86,657,002 noncoding transcript Het
Gm6990 T A 19: 56,755,334 noncoding transcript Het
Gpr61 A G 3: 108,150,481 V288A possibly damaging Het
Grik3 G A 4: 125,704,564 probably benign Het
Haao T A 17: 83,838,838 Q69L probably benign Het
Ints6 T C 14: 62,704,903 probably benign Het
Ints8 T C 4: 11,221,204 I724V possibly damaging Het
Lrrk2 G A 15: 91,728,920 C749Y probably damaging Het
Map4k1 A G 7: 28,998,452 D471G possibly damaging Het
Mbtd1 A G 11: 93,910,359 Y122C probably damaging Het
Mrfap1 A G 5: 36,796,473 S41P possibly damaging Het
Mrm2 T C 5: 140,328,553 T176A probably benign Het
Mslnl T C 17: 25,743,240 L204P probably damaging Het
Muc6 T C 7: 141,651,879 E112G probably benign Het
Nfyb A G 10: 82,750,831 probably benign Het
Nlgn3 T C X: 101,308,916 probably benign Het
Nr3c1 G A 18: 39,486,998 Q79* probably null Het
Nxpe4 C G 9: 48,396,493 T299R probably benign Het
Otud4 C A 8: 79,673,974 H1105N unknown Het
Pcnx2 A G 8: 125,773,833 L1506P probably damaging Het
Prl2c5 T A 13: 13,189,424 H88Q probably damaging Het
Psmb2 A G 4: 126,687,032 Y73C probably damaging Het
Rbl1 A T 2: 157,169,971 V688D probably benign Het
Rhox2g C A X: 37,643,212 probably benign Het
Rmnd5a G A 6: 71,398,455 L80F probably benign Het
Ryr2 T C 13: 11,687,879 probably benign Het
Sele T A 1: 164,050,810 S239R probably damaging Het
Slc23a1 C T 18: 35,622,623 V407M possibly damaging Het
Slc6a14 G A X: 21,721,568 V122I probably benign Het
Spdl1 T A 11: 34,813,607 E466D unknown Het
Stau2 A G 1: 16,440,372 F121L probably benign Het
Stxbp1 A T 2: 32,794,636 S594T probably benign Het
Sufu G A 19: 46,454,720 probably benign Het
Tap2 G T 17: 34,211,915 V330L probably benign Het
Tbc1d1 T C 5: 64,264,432 L389P probably damaging Het
Tbx2 A G 11: 85,834,766 E181G probably damaging Het
Tmem56 A G 3: 121,207,291 V231A probably benign Het
Tmprss9 G T 10: 80,890,445 A510S probably benign Het
Tnxb G A 17: 34,671,577 C298Y probably damaging Het
Tril G T 6: 53,818,027 R737S probably damaging Het
Ugt2a3 A T 5: 87,327,146 L413Q probably damaging Het
Vcan A G 13: 89,657,556 I2335T probably damaging Het
Vmn2r28 T C 7: 5,481,545 N552S possibly damaging Het
Zc3h7a C T 16: 11,161,026 R95H probably damaging Het
Zfp598 A G 17: 24,679,649 N474S probably benign Het
Zpld1 T C 16: 55,248,334 D138G probably damaging Het
Other mutations in Siglecf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Siglecf APN 7 43351953 nonsense probably null
IGL01350:Siglecf APN 7 43355895 intron probably benign
IGL01458:Siglecf APN 7 43355138 missense possibly damaging 0.46
IGL01582:Siglecf APN 7 43358721 missense possibly damaging 0.55
IGL02347:Siglecf APN 7 43351721 missense possibly damaging 0.78
IGL02530:Siglecf APN 7 43352210 missense probably benign 0.07
IGL02700:Siglecf APN 7 43352378 missense probably damaging 1.00
IGL03093:Siglecf APN 7 43352441 missense probably damaging 1.00
IGL03178:Siglecf APN 7 43358739 missense probably damaging 0.98
IGL03280:Siglecf APN 7 43355930 missense probably benign 0.04
ANU23:Siglecf UTSW 7 43351953 nonsense probably null
R0003:Siglecf UTSW 7 43355926 missense probably benign
R0025:Siglecf UTSW 7 43351925 missense probably benign 0.29
R0304:Siglecf UTSW 7 43352401 missense probably damaging 1.00
R0345:Siglecf UTSW 7 43351944 missense probably damaging 1.00
R0395:Siglecf UTSW 7 43355975 missense probably damaging 1.00
R0515:Siglecf UTSW 7 43355631 critical splice donor site probably null
R1861:Siglecf UTSW 7 43352224 missense probably benign 0.00
R1861:Siglecf UTSW 7 43355543 missense probably benign 0.01
R1869:Siglecf UTSW 7 43355543 missense probably benign 0.01
R1870:Siglecf UTSW 7 43355543 missense probably benign 0.01
R1871:Siglecf UTSW 7 43355543 missense probably benign 0.01
R2063:Siglecf UTSW 7 43352380 missense possibly damaging 0.79
R2176:Siglecf UTSW 7 43351716 missense probably damaging 0.98
R2237:Siglecf UTSW 7 43354985 missense probably benign 0.06
R4023:Siglecf UTSW 7 43355571 missense possibly damaging 0.56
R4498:Siglecf UTSW 7 43352276 missense possibly damaging 0.47
R4664:Siglecf UTSW 7 43356413 missense possibly damaging 0.75
R5227:Siglecf UTSW 7 43351940 missense probably damaging 1.00
R5315:Siglecf UTSW 7 43355108 missense probably benign 0.01
R5763:Siglecf UTSW 7 43356320 nonsense probably null
R5828:Siglecf UTSW 7 43351713 missense probably damaging 1.00
R5871:Siglecf UTSW 7 43355621 missense probably benign 0.04
R5952:Siglecf UTSW 7 43355927 missense probably benign 0.00
R6054:Siglecf UTSW 7 43355006 missense probably damaging 1.00
R6537:Siglecf UTSW 7 43355999 missense probably benign
R6854:Siglecf UTSW 7 43352180 missense probably benign 0.00
R6875:Siglecf UTSW 7 43355200 missense probably benign 0.04
R7328:Siglecf UTSW 7 43352267 missense possibly damaging 0.92
R7329:Siglecf UTSW 7 43351971 missense probably damaging 1.00
R7356:Siglecf UTSW 7 43356431 missense probably benign 0.00
R7369:Siglecf UTSW 7 43351817 missense probably damaging 0.99
R7659:Siglecf UTSW 7 43351770 missense probably damaging 1.00
R8074:Siglecf UTSW 7 43351790 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TTCCACAATGGCATGGGGAGTGAG -3'
(R):5'- CCCACTGGGCTGAGTTTTAGGAATC -3'

Sequencing Primer
(F):5'- AGCAAAATGGGACTAGTGTTTGTG -3'
(R):5'- GGCTGAGTTTTAGGAATCCTTTAACC -3'
Posted On2014-02-18