Incidental Mutation 'R1296:Col6a6'
ID 158136
Institutional Source Beutler Lab
Gene Symbol Col6a6
Ensembl Gene ENSMUSG00000043719
Gene Name collagen, type VI, alpha 6
Synonyms E330026B02Rik
MMRRC Submission 039362-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock # R1296 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 105687809-105828160 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 105781091 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 641 (K641E)
Ref Sequence ENSEMBL: ENSMUSP00000096040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060896] [ENSMUST00000098441] [ENSMUST00000166431]
AlphaFold Q8C6K9
Predicted Effect probably damaging
Transcript: ENSMUST00000060896
AA Change: K641E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000060840
Gene: ENSMUSG00000043719
AA Change: K641E

DomainStartEndE-ValueType
VWA 24 197 4.26e-26 SMART
VWA 226 407 1.06e-30 SMART
VWA 433 610 5.19e-39 SMART
VWA 619 795 3.58e-42 SMART
VWA 806 982 6.64e-37 SMART
VWA 997 1175 2.7e-37 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000098441
AA Change: K641E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096040
Gene: ENSMUSG00000043719
AA Change: K641E

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
VWA 24 197 4.26e-26 SMART
VWA 226 407 1.06e-30 SMART
VWA 433 610 5.19e-39 SMART
VWA 619 795 3.58e-42 SMART
VWA 806 982 6.64e-37 SMART
VWA 997 1175 2.7e-37 SMART
VWA 1184 1370 3.45e-1 SMART
Pfam:Collagen 1389 1450 3.3e-9 PFAM
low complexity region 1451 1475 N/A INTRINSIC
low complexity region 1490 1508 N/A INTRINSIC
low complexity region 1602 1623 N/A INTRINSIC
low complexity region 1698 1724 N/A INTRINSIC
VWA 1754 1937 1.73e-17 SMART
VWA 1962 2145 4.4e-19 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000166431
AA Change: K641E

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000125765
Gene: ENSMUSG00000043719
AA Change: K641E

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
VWA 24 197 4.26e-26 SMART
VWA 226 407 1.06e-30 SMART
VWA 433 610 5.19e-39 SMART
VWA 619 795 3.58e-42 SMART
VWA 806 982 6.64e-37 SMART
VWA 997 1175 2.7e-37 SMART
VWA 1184 1370 3.45e-1 SMART
Pfam:Collagen 1389 1450 9.3e-10 PFAM
low complexity region 1451 1475 N/A INTRINSIC
low complexity region 1490 1508 N/A INTRINSIC
low complexity region 1602 1623 N/A INTRINSIC
low complexity region 1698 1724 N/A INTRINSIC
VWA 1754 1937 1.73e-17 SMART
VWA 1962 2145 4.4e-19 SMART
Meta Mutation Damage Score 0.3728 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.5%
  • 20x: 87.1%
Validation Efficiency 100% (72/72)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam29 G A 8: 55,871,719 Q567* probably null Het
Apol11a T C 15: 77,511,019 probably benign Het
Arhgap29 A G 3: 121,992,395 H275R probably benign Het
Arhgef17 C A 7: 100,881,269 E428* probably null Het
Atm A T 9: 53,456,530 V2431E probably damaging Het
Atn1 G T 6: 124,747,787 P161Q unknown Het
Atp13a2 T C 4: 140,993,802 S99P probably damaging Het
Atp8a1 A T 5: 67,622,706 probably benign Het
Cbwd1 A T 19: 24,942,675 probably benign Het
Cdk18 T C 1: 132,119,960 probably benign Het
Cep85 A G 4: 134,167,400 W32R probably damaging Het
Cntn4 G T 6: 106,509,402 G264C probably damaging Het
Col6a4 A G 9: 106,062,853 S1293P possibly damaging Het
Dmd A T X: 83,878,520 K1465N probably damaging Het
Dus2 T C 8: 106,053,043 V403A possibly damaging Het
Frs2 C T 10: 117,081,074 C5Y probably benign Het
Gm5174 A G 10: 86,657,002 noncoding transcript Het
Gm6990 T A 19: 56,755,334 noncoding transcript Het
Gpr61 A G 3: 108,150,481 V288A possibly damaging Het
Grik3 G A 4: 125,704,564 probably benign Het
Haao T A 17: 83,838,838 Q69L probably benign Het
Ints6 T C 14: 62,704,903 probably benign Het
Ints8 T C 4: 11,221,204 I724V possibly damaging Het
Lrrk2 G A 15: 91,728,920 C749Y probably damaging Het
Map4k1 A G 7: 28,998,452 D471G possibly damaging Het
Mbtd1 A G 11: 93,910,359 Y122C probably damaging Het
Mrfap1 A G 5: 36,796,473 S41P possibly damaging Het
Mrm2 T C 5: 140,328,553 T176A probably benign Het
Mslnl T C 17: 25,743,240 L204P probably damaging Het
Muc6 T C 7: 141,651,879 E112G probably benign Het
Nfyb A G 10: 82,750,831 probably benign Het
Nlgn3 T C X: 101,308,916 probably benign Het
Nr3c1 G A 18: 39,486,998 Q79* probably null Het
Nxpe4 C G 9: 48,396,493 T299R probably benign Het
Otud4 C A 8: 79,673,974 H1105N unknown Het
Pcnx2 A G 8: 125,773,833 L1506P probably damaging Het
Prl2c5 T A 13: 13,189,424 H88Q probably damaging Het
Psmb2 A G 4: 126,687,032 Y73C probably damaging Het
Rbl1 A T 2: 157,169,971 V688D probably benign Het
Rhox2g C A X: 37,643,212 probably benign Het
Rmnd5a G A 6: 71,398,455 L80F probably benign Het
Ryr2 T C 13: 11,687,879 probably benign Het
Sele T A 1: 164,050,810 S239R probably damaging Het
Siglecf A T 7: 43,355,920 R435* probably null Het
Slc23a1 C T 18: 35,622,623 V407M possibly damaging Het
Slc6a14 G A X: 21,721,568 V122I probably benign Het
Spdl1 T A 11: 34,813,607 E466D unknown Het
Stau2 A G 1: 16,440,372 F121L probably benign Het
Stxbp1 A T 2: 32,794,636 S594T probably benign Het
Sufu G A 19: 46,454,720 probably benign Het
Tap2 G T 17: 34,211,915 V330L probably benign Het
Tbc1d1 T C 5: 64,264,432 L389P probably damaging Het
Tbx2 A G 11: 85,834,766 E181G probably damaging Het
Tmem56 A G 3: 121,207,291 V231A probably benign Het
Tmprss9 G T 10: 80,890,445 A510S probably benign Het
Tnxb G A 17: 34,671,577 C298Y probably damaging Het
Tril G T 6: 53,818,027 R737S probably damaging Het
Ugt2a3 A T 5: 87,327,146 L413Q probably damaging Het
Vcan A G 13: 89,657,556 I2335T probably damaging Het
Vmn2r28 T C 7: 5,481,545 N552S possibly damaging Het
Zc3h7a C T 16: 11,161,026 R95H probably damaging Het
Zfp598 A G 17: 24,679,649 N474S probably benign Het
Zpld1 T C 16: 55,248,334 D138G probably damaging Het
Other mutations in Col6a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Col6a6 APN 9 105758191 critical splice acceptor site probably null
IGL00768:Col6a6 APN 9 105782412 missense probably benign 0.04
IGL00917:Col6a6 APN 9 105784254 splice site probably benign
IGL01385:Col6a6 APN 9 105783666 missense probably damaging 1.00
IGL01411:Col6a6 APN 9 105785958 nonsense probably null
IGL01508:Col6a6 APN 9 105727166 splice site probably benign
IGL01668:Col6a6 APN 9 105709271 missense probably damaging 1.00
IGL01733:Col6a6 APN 9 105709255 missense possibly damaging 0.92
IGL01932:Col6a6 APN 9 105689626 missense probably benign 0.02
IGL01934:Col6a6 APN 9 105698659 critical splice donor site probably null
IGL01944:Col6a6 APN 9 105783909 missense probably damaging 1.00
IGL01980:Col6a6 APN 9 105780985 missense probably damaging 0.96
IGL02114:Col6a6 APN 9 105767199 critical splice donor site probably null
IGL02129:Col6a6 APN 9 105736340 splice site probably benign
IGL02201:Col6a6 APN 9 105780995 missense probably damaging 1.00
IGL02335:Col6a6 APN 9 105784101 missense probably damaging 1.00
IGL02541:Col6a6 APN 9 105732216 missense probably benign 0.05
IGL02574:Col6a6 APN 9 105782191 missense probably damaging 1.00
IGL02649:Col6a6 APN 9 105727170 critical splice donor site probably null
IGL02852:Col6a6 APN 9 105784073 missense probably damaging 0.99
IGL03278:Col6a6 APN 9 105709452 missense probably benign 0.01
IGL03327:Col6a6 APN 9 105767234 missense possibly damaging 0.90
PIT4519001:Col6a6 UTSW 9 105732263 missense probably benign 0.23
R0042:Col6a6 UTSW 9 105780697 missense possibly damaging 0.89
R0046:Col6a6 UTSW 9 105748848 splice site probably benign
R0066:Col6a6 UTSW 9 105702213 missense probably damaging 0.99
R0066:Col6a6 UTSW 9 105702213 missense probably damaging 0.99
R0140:Col6a6 UTSW 9 105702275 missense probably damaging 1.00
R0278:Col6a6 UTSW 9 105767288 missense possibly damaging 0.87
R0281:Col6a6 UTSW 9 105784116 missense probably benign 0.13
R0382:Col6a6 UTSW 9 105755555 missense probably damaging 0.98
R0389:Col6a6 UTSW 9 105784204 missense probably benign 0.02
R0421:Col6a6 UTSW 9 105784206 missense probably benign 0.02
R0502:Col6a6 UTSW 9 105767351 missense probably benign 0.04
R0503:Col6a6 UTSW 9 105767351 missense probably benign 0.04
R0600:Col6a6 UTSW 9 105761440 missense probably damaging 1.00
R0626:Col6a6 UTSW 9 105777744 missense probably benign 0.45
R0629:Col6a6 UTSW 9 105727165 splice site probably benign
R0690:Col6a6 UTSW 9 105709486 missense probably benign 0.01
R1155:Col6a6 UTSW 9 105782090 missense possibly damaging 0.64
R1245:Col6a6 UTSW 9 105748910 missense possibly damaging 0.62
R1253:Col6a6 UTSW 9 105774303 missense probably null 0.98
R1263:Col6a6 UTSW 9 105709489 missense probably benign 0.01
R1556:Col6a6 UTSW 9 105709473 missense possibly damaging 0.82
R1600:Col6a6 UTSW 9 105778075 missense probably damaging 1.00
R1612:Col6a6 UTSW 9 105777549 missense probably damaging 1.00
R1613:Col6a6 UTSW 9 105732211 critical splice donor site probably null
R1830:Col6a6 UTSW 9 105702270 missense probably damaging 0.99
R1858:Col6a6 UTSW 9 105781102 missense probably damaging 1.00
R1897:Col6a6 UTSW 9 105785744 missense possibly damaging 0.74
R1944:Col6a6 UTSW 9 105709384 missense probably damaging 1.00
R2366:Col6a6 UTSW 9 105755694 missense probably damaging 1.00
R2484:Col6a6 UTSW 9 105780804 missense probably damaging 0.98
R3079:Col6a6 UTSW 9 105754223 missense probably benign 0.01
R3176:Col6a6 UTSW 9 105786230 missense probably benign 0.01
R3276:Col6a6 UTSW 9 105786230 missense probably benign 0.01
R3429:Col6a6 UTSW 9 105777967 missense probably damaging 1.00
R3716:Col6a6 UTSW 9 105782174 missense probably damaging 0.98
R3809:Col6a6 UTSW 9 105780692 missense probably damaging 1.00
R3978:Col6a6 UTSW 9 105698879 missense probably damaging 0.98
R4087:Col6a6 UTSW 9 105783956 missense possibly damaging 0.68
R4382:Col6a6 UTSW 9 105783690 missense probably damaging 1.00
R4516:Col6a6 UTSW 9 105698949 missense possibly damaging 0.64
R4666:Col6a6 UTSW 9 105767342 missense possibly damaging 0.93
R4905:Col6a6 UTSW 9 105767424 missense probably damaging 1.00
R4923:Col6a6 UTSW 9 105788948 missense probably damaging 1.00
R4951:Col6a6 UTSW 9 105767198 critical splice donor site probably null
R5002:Col6a6 UTSW 9 105786093 missense probably benign 0.00
R5111:Col6a6 UTSW 9 105709474 missense possibly damaging 0.70
R5205:Col6a6 UTSW 9 105782033 missense probably damaging 0.99
R5399:Col6a6 UTSW 9 105709107 missense possibly damaging 0.50
R5475:Col6a6 UTSW 9 105774338 missense probably null 0.79
R5491:Col6a6 UTSW 9 105738236 missense probably damaging 0.98
R5758:Col6a6 UTSW 9 105761518 critical splice acceptor site probably null
R5934:Col6a6 UTSW 9 105767075 missense probably damaging 1.00
R6059:Col6a6 UTSW 9 105783917 missense probably damaging 1.00
R6284:Col6a6 UTSW 9 105727227 splice site probably null
R6425:Col6a6 UTSW 9 105698865 missense probably benign 0.21
R6464:Col6a6 UTSW 9 105788953 start codon destroyed probably null 0.60
R6469:Col6a6 UTSW 9 105698691 missense probably damaging 0.97
R6520:Col6a6 UTSW 9 105785825 missense possibly damaging 0.89
R6552:Col6a6 UTSW 9 105698913 missense probably damaging 1.00
R6750:Col6a6 UTSW 9 105783680 missense probably damaging 1.00
R6813:Col6a6 UTSW 9 105783941 missense probably benign 0.32
R7032:Col6a6 UTSW 9 105767508 missense probably damaging 0.96
R7260:Col6a6 UTSW 9 105783969 missense probably benign 0.00
R7472:Col6a6 UTSW 9 105782423 missense probably damaging 1.00
R7541:Col6a6 UTSW 9 105767324 missense probably damaging 1.00
R7640:Col6a6 UTSW 9 105785744 missense possibly damaging 0.74
R7645:Col6a6 UTSW 9 105767198 critical splice donor site probably null
R7716:Col6a6 UTSW 9 105783903 missense possibly damaging 0.84
R7866:Col6a6 UTSW 9 105689561 missense probably damaging 0.96
R7938:Col6a6 UTSW 9 105780684 nonsense probably null
R8016:Col6a6 UTSW 9 105767528 missense possibly damaging 0.73
R8043:Col6a6 UTSW 9 105699020 missense probably damaging 0.98
R8073:Col6a6 UTSW 9 105781947 missense probably benign 0.01
R8082:Col6a6 UTSW 9 105783930 nonsense probably null
R8243:Col6a6 UTSW 9 105699269 missense probably damaging 1.00
R8306:Col6a6 UTSW 9 105784073 missense probably damaging 0.96
R8324:Col6a6 UTSW 9 105755654 missense probably benign 0.25
R8384:Col6a6 UTSW 9 105755694 missense probably damaging 1.00
R8400:Col6a6 UTSW 9 105774796 missense probably damaging 1.00
R8523:Col6a6 UTSW 9 105774788 missense possibly damaging 0.71
R8842:Col6a6 UTSW 9 105777967 missense probably damaging 1.00
R8862:Col6a6 UTSW 9 105786149 missense probably damaging 1.00
R8907:Col6a6 UTSW 9 105767329 missense probably damaging 0.99
R9021:Col6a6 UTSW 9 105709546 missense possibly damaging 0.85
R9088:Col6a6 UTSW 9 105784077 missense probably damaging 0.99
R9178:Col6a6 UTSW 9 105781970 missense probably benign 0.30
R9225:Col6a6 UTSW 9 105782238 missense possibly damaging 0.75
R9340:Col6a6 UTSW 9 105774558 missense probably damaging 1.00
R9342:Col6a6 UTSW 9 105785973 missense probably benign 0.00
R9360:Col6a6 UTSW 9 105767487 missense probably benign 0.00
R9368:Col6a6 UTSW 9 105786101 missense possibly damaging 0.48
R9398:Col6a6 UTSW 9 105774626 missense probably benign 0.40
R9450:Col6a6 UTSW 9 105784174 missense probably benign
R9454:Col6a6 UTSW 9 105783860 missense probably damaging 0.99
R9458:Col6a6 UTSW 9 105709162 missense probably benign 0.01
R9563:Col6a6 UTSW 9 105695753 missense probably benign 0.02
R9568:Col6a6 UTSW 9 105780727 missense possibly damaging 0.58
R9613:Col6a6 UTSW 9 105739202 missense probably benign 0.07
X0022:Col6a6 UTSW 9 105699332 missense probably damaging 1.00
Z1176:Col6a6 UTSW 9 105780952 missense probably damaging 1.00
Z1177:Col6a6 UTSW 9 105728255 missense probably damaging 1.00
Z1177:Col6a6 UTSW 9 105788895 missense probably null 0.24
Predicted Primers PCR Primer
(F):5'- GACATTGGAGCCGAATACTCCCAC -3'
(R):5'- TATGATGCACACCCTGGGCTTGAAC -3'

Sequencing Primer
(F):5'- CCCTTATCGGGACTGAAGTACTG -3'
(R):5'- CTGGGCTTGAACACAGAATTATTTG -3'
Posted On 2014-02-18