Incidental Mutation 'R1296:Frs2'
ID158141
Institutional Source Beutler Lab
Gene Symbol Frs2
Ensembl Gene ENSMUSG00000020170
Gene Namefibroblast growth factor receptor substrate 2
SynonymsSNT1, Frs2alpha, C330018A15Rik
MMRRC Submission 039362-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1296 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location117069427-117148534 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 117081074 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 5 (C5Y)
Ref Sequence ENSEMBL: ENSMUSP00000020381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020381]
Predicted Effect probably benign
Transcript: ENSMUST00000020381
AA Change: C5Y

PolyPhen 2 Score 0.301 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000020381
Gene: ENSMUSG00000020170
AA Change: C5Y

DomainStartEndE-ValueType
IRS 17 110 2.04e-34 SMART
PTBI 18 110 5.71e-35 SMART
low complexity region 130 139 N/A INTRINSIC
low complexity region 450 468 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218868
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219483
Meta Mutation Damage Score 0.3175 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.5%
  • 20x: 87.1%
Validation Efficiency 100% (72/72)
MGI Phenotype PHENOTYPE: Homozygous null mice exhibit embryonic lethality between E5.75 and E8 and defects in primitive streak formation and anterior-posterior axis formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam29 G A 8: 55,871,719 Q567* probably null Het
Apol11a T C 15: 77,511,019 probably benign Het
Arhgap29 A G 3: 121,992,395 H275R probably benign Het
Arhgef17 C A 7: 100,881,269 E428* probably null Het
Atm A T 9: 53,456,530 V2431E probably damaging Het
Atn1 G T 6: 124,747,787 P161Q unknown Het
Atp13a2 T C 4: 140,993,802 S99P probably damaging Het
Atp8a1 A T 5: 67,622,706 probably benign Het
Cbwd1 A T 19: 24,942,675 probably benign Het
Cdk18 T C 1: 132,119,960 probably benign Het
Cep85 A G 4: 134,167,400 W32R probably damaging Het
Cntn4 G T 6: 106,509,402 G264C probably damaging Het
Col6a4 A G 9: 106,062,853 S1293P possibly damaging Het
Col6a6 T C 9: 105,781,091 K641E probably damaging Het
Dmd A T X: 83,878,520 K1465N probably damaging Het
Dus2 T C 8: 106,053,043 V403A possibly damaging Het
Gm5174 A G 10: 86,657,002 noncoding transcript Het
Gm6990 T A 19: 56,755,334 noncoding transcript Het
Gpr61 A G 3: 108,150,481 V288A possibly damaging Het
Grik3 G A 4: 125,704,564 probably benign Het
Haao T A 17: 83,838,838 Q69L probably benign Het
Ints6 T C 14: 62,704,903 probably benign Het
Ints8 T C 4: 11,221,204 I724V possibly damaging Het
Lrrk2 G A 15: 91,728,920 C749Y probably damaging Het
Map4k1 A G 7: 28,998,452 D471G possibly damaging Het
Mbtd1 A G 11: 93,910,359 Y122C probably damaging Het
Mrfap1 A G 5: 36,796,473 S41P possibly damaging Het
Mrm2 T C 5: 140,328,553 T176A probably benign Het
Mslnl T C 17: 25,743,240 L204P probably damaging Het
Muc6 T C 7: 141,651,879 E112G probably benign Het
Nfyb A G 10: 82,750,831 probably benign Het
Nlgn3 T C X: 101,308,916 probably benign Het
Nr3c1 G A 18: 39,486,998 Q79* probably null Het
Nxpe4 C G 9: 48,396,493 T299R probably benign Het
Otud4 C A 8: 79,673,974 H1105N unknown Het
Pcnx2 A G 8: 125,773,833 L1506P probably damaging Het
Prl2c5 T A 13: 13,189,424 H88Q probably damaging Het
Psmb2 A G 4: 126,687,032 Y73C probably damaging Het
Rbl1 A T 2: 157,169,971 V688D probably benign Het
Rhox2g C A X: 37,643,212 probably benign Het
Rmnd5a G A 6: 71,398,455 L80F probably benign Het
Ryr2 T C 13: 11,687,879 probably benign Het
Sele T A 1: 164,050,810 S239R probably damaging Het
Siglecf A T 7: 43,355,920 R435* probably null Het
Slc23a1 C T 18: 35,622,623 V407M possibly damaging Het
Slc6a14 G A X: 21,721,568 V122I probably benign Het
Spdl1 T A 11: 34,813,607 E466D unknown Het
Stau2 A G 1: 16,440,372 F121L probably benign Het
Stxbp1 A T 2: 32,794,636 S594T probably benign Het
Sufu G A 19: 46,454,720 probably benign Het
Tap2 G T 17: 34,211,915 V330L probably benign Het
Tbc1d1 T C 5: 64,264,432 L389P probably damaging Het
Tbx2 A G 11: 85,834,766 E181G probably damaging Het
Tmem56 A G 3: 121,207,291 V231A probably benign Het
Tmprss9 G T 10: 80,890,445 A510S probably benign Het
Tnxb G A 17: 34,671,577 C298Y probably damaging Het
Tril G T 6: 53,818,027 R737S probably damaging Het
Ugt2a3 A T 5: 87,327,146 L413Q probably damaging Het
Vcan A G 13: 89,657,556 I2335T probably damaging Het
Vmn2r28 T C 7: 5,481,545 N552S possibly damaging Het
Zc3h7a C T 16: 11,161,026 R95H probably damaging Het
Zfp598 A G 17: 24,679,649 N474S probably benign Het
Zpld1 T C 16: 55,248,334 D138G probably damaging Het
Other mutations in Frs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00807:Frs2 APN 10 117074886 splice site probably benign
IGL02300:Frs2 APN 10 117077591 missense possibly damaging 0.67
IGL03028:Frs2 APN 10 117073933 missense possibly damaging 0.66
R0001:Frs2 UTSW 10 117074876 missense possibly damaging 0.76
R0513:Frs2 UTSW 10 117074665 missense possibly damaging 0.86
R0708:Frs2 UTSW 10 117074092 missense probably damaging 0.99
R0735:Frs2 UTSW 10 117074582 missense probably damaging 1.00
R1934:Frs2 UTSW 10 117078901 missense probably damaging 0.99
R1938:Frs2 UTSW 10 117081106 start gained probably benign
R1992:Frs2 UTSW 10 117074554 missense probably benign
R2095:Frs2 UTSW 10 117074602 missense probably benign 0.00
R3878:Frs2 UTSW 10 117078910 missense probably benign 0.01
R4732:Frs2 UTSW 10 117074093 missense probably benign 0.31
R4733:Frs2 UTSW 10 117074093 missense probably benign 0.31
R5186:Frs2 UTSW 10 117078842 missense probably damaging 1.00
R5326:Frs2 UTSW 10 117077563 missense probably benign 0.00
R5894:Frs2 UTSW 10 117081106 start gained probably benign
R6084:Frs2 UTSW 10 117076809 critical splice donor site probably null
R7468:Frs2 UTSW 10 117074102 missense possibly damaging 0.86
R7603:Frs2 UTSW 10 117074063 missense probably benign 0.03
Z1177:Frs2 UTSW 10 117074379 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAGAGCTGTGAACTGAGCGCAC -3'
(R):5'- GCATTCTTTCCTGCATCGAAGCACC -3'

Sequencing Primer
(F):5'- tgactgctcttccaaaggac -3'
(R):5'- ACCATGCTTACACGGGATG -3'
Posted On2014-02-18