Incidental Mutation 'R1296:Haao'
ID158158
Institutional Source Beutler Lab
Gene Symbol Haao
Ensembl Gene ENSMUSG00000000673
Gene Name3-hydroxyanthranilate 3,4-dioxygenase
Synonyms3HAO, 0610012J07Rik, 0610007K21Rik, 3-HAO, 3-HAOxase
MMRRC Submission 039362-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1296 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location83831356-83846790 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 83838838 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 69 (Q69L)
Ref Sequence ENSEMBL: ENSMUSP00000000687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000687]
Predicted Effect probably benign
Transcript: ENSMUST00000000687
AA Change: Q69L

PolyPhen 2 Score 0.377 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000000687
Gene: ENSMUSG00000000673
AA Change: Q69L

DomainStartEndE-ValueType
Pfam:3-HAO 1 149 1e-78 PFAM
Meta Mutation Damage Score 0.2352 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.5%
  • 20x: 87.1%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] 3-Hydroxyanthranilate 3,4-dioxygenase is a monomeric cytosolic protein belonging to the family of intramolecular dioxygenases containing nonheme ferrous iron. It is widely distributed in peripheral organs, such as liver and kidney, and is also present in low amounts in the central nervous system. HAAO catalyzes the synthesis of quinolinic acid (QUIN) from 3-hydroxyanthranilic acid. QUIN is an excitotoxin whose toxicity is mediated by its ability to activate glutamate N-methyl-D-aspartate receptors. Increased cerebral levels of QUIN may participate in the pathogenesis of neurologic and inflammatory disorders. HAAO has been suggested to play a role in disorders associated with altered tissue levels of QUIN. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced LPS-induced depressive behaviors and altered kynurenine metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam29 G A 8: 55,871,719 Q567* probably null Het
Apol11a T C 15: 77,511,019 probably benign Het
Arhgap29 A G 3: 121,992,395 H275R probably benign Het
Arhgef17 C A 7: 100,881,269 E428* probably null Het
Atm A T 9: 53,456,530 V2431E probably damaging Het
Atn1 G T 6: 124,747,787 P161Q unknown Het
Atp13a2 T C 4: 140,993,802 S99P probably damaging Het
Atp8a1 A T 5: 67,622,706 probably benign Het
Cbwd1 A T 19: 24,942,675 probably benign Het
Cdk18 T C 1: 132,119,960 probably benign Het
Cep85 A G 4: 134,167,400 W32R probably damaging Het
Cntn4 G T 6: 106,509,402 G264C probably damaging Het
Col6a4 A G 9: 106,062,853 S1293P possibly damaging Het
Col6a6 T C 9: 105,781,091 K641E probably damaging Het
Dmd A T X: 83,878,520 K1465N probably damaging Het
Dus2 T C 8: 106,053,043 V403A possibly damaging Het
Frs2 C T 10: 117,081,074 C5Y probably benign Het
Gm5174 A G 10: 86,657,002 noncoding transcript Het
Gm6990 T A 19: 56,755,334 noncoding transcript Het
Gpr61 A G 3: 108,150,481 V288A possibly damaging Het
Grik3 G A 4: 125,704,564 probably benign Het
Ints6 T C 14: 62,704,903 probably benign Het
Ints8 T C 4: 11,221,204 I724V possibly damaging Het
Lrrk2 G A 15: 91,728,920 C749Y probably damaging Het
Map4k1 A G 7: 28,998,452 D471G possibly damaging Het
Mbtd1 A G 11: 93,910,359 Y122C probably damaging Het
Mrfap1 A G 5: 36,796,473 S41P possibly damaging Het
Mrm2 T C 5: 140,328,553 T176A probably benign Het
Mslnl T C 17: 25,743,240 L204P probably damaging Het
Muc6 T C 7: 141,651,879 E112G probably benign Het
Nfyb A G 10: 82,750,831 probably benign Het
Nlgn3 T C X: 101,308,916 probably benign Het
Nr3c1 G A 18: 39,486,998 Q79* probably null Het
Nxpe4 C G 9: 48,396,493 T299R probably benign Het
Otud4 C A 8: 79,673,974 H1105N unknown Het
Pcnx2 A G 8: 125,773,833 L1506P probably damaging Het
Prl2c5 T A 13: 13,189,424 H88Q probably damaging Het
Psmb2 A G 4: 126,687,032 Y73C probably damaging Het
Rbl1 A T 2: 157,169,971 V688D probably benign Het
Rhox2g C A X: 37,643,212 probably benign Het
Rmnd5a G A 6: 71,398,455 L80F probably benign Het
Ryr2 T C 13: 11,687,879 probably benign Het
Sele T A 1: 164,050,810 S239R probably damaging Het
Siglecf A T 7: 43,355,920 R435* probably null Het
Slc23a1 C T 18: 35,622,623 V407M possibly damaging Het
Slc6a14 G A X: 21,721,568 V122I probably benign Het
Spdl1 T A 11: 34,813,607 E466D unknown Het
Stau2 A G 1: 16,440,372 F121L probably benign Het
Stxbp1 A T 2: 32,794,636 S594T probably benign Het
Sufu G A 19: 46,454,720 probably benign Het
Tap2 G T 17: 34,211,915 V330L probably benign Het
Tbc1d1 T C 5: 64,264,432 L389P probably damaging Het
Tbx2 A G 11: 85,834,766 E181G probably damaging Het
Tmem56 A G 3: 121,207,291 V231A probably benign Het
Tmprss9 G T 10: 80,890,445 A510S probably benign Het
Tnxb G A 17: 34,671,577 C298Y probably damaging Het
Tril G T 6: 53,818,027 R737S probably damaging Het
Ugt2a3 A T 5: 87,327,146 L413Q probably damaging Het
Vcan A G 13: 89,657,556 I2335T probably damaging Het
Vmn2r28 T C 7: 5,481,545 N552S possibly damaging Het
Zc3h7a C T 16: 11,161,026 R95H probably damaging Het
Zfp598 A G 17: 24,679,649 N474S probably benign Het
Zpld1 T C 16: 55,248,334 D138G probably damaging Het
Other mutations in Haao
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Haao APN 17 83834930 splice site probably benign
IGL01728:Haao APN 17 83835229 missense probably damaging 1.00
IGL02603:Haao APN 17 83835541 missense probably benign 0.45
IGL03328:Haao APN 17 83846649 missense probably damaging 1.00
R0635:Haao UTSW 17 83838574 missense probably damaging 1.00
R1295:Haao UTSW 17 83838838 missense probably benign 0.38
R1472:Haao UTSW 17 83838838 missense probably benign 0.38
R1563:Haao UTSW 17 83834889 missense probably benign 0.01
R2424:Haao UTSW 17 83835562 missense probably damaging 0.99
R3917:Haao UTSW 17 83838799 critical splice donor site probably null
R4657:Haao UTSW 17 83832345 missense possibly damaging 0.67
R4857:Haao UTSW 17 83838580 critical splice acceptor site probably null
R6475:Haao UTSW 17 83831684 missense possibly damaging 0.87
R6989:Haao UTSW 17 83831674 missense probably damaging 1.00
R7390:Haao UTSW 17 83846652 missense probably damaging 0.99
R8073:Haao UTSW 17 83835220 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- GAATGTTGAGCTGTGCTCAGGAAGG -3'
(R):5'- CGATGCTAACGCTAACGATGCAGAC -3'

Sequencing Primer
(F):5'- CTCAGGAAGGGGGAGCC -3'
(R):5'- AGGAATATCTCCACTGCTGTG -3'
Posted On2014-02-18