Mutagenetix > Incidental Mutations

Incidental Mutation 'R1297:Pgap1'

158168

Institutional Source

Beutler Lab

Gene Symbol

Pgap1

Ensembl Gene

ENSMUSG00000073678

Gene Name

post-GPI attachment to proteins 1

Synonyms

PGAP1, D230012E17Rik, oto, 5033403E17Rik, 9030223K07Rik

MMRRC Submission

039363-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.862) question?

Stock #

R1297 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

54472994-54557684 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 54528523 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 388 (S388G)

Ref Sequence

ENSEMBL: ENSMUSP00000095346 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000097739]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000097739
AA Change: S388G

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000095346
Gene: ENSMUSG00000073678
AA Change: S388G

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:PGAP1	82	302	7.2e-83	PFAM
transmembrane domain	597	619	N/A	INTRINSIC
transmembrane domain	678	700	N/A	INTRINSIC
transmembrane domain	737	759	N/A	INTRINSIC
transmembrane domain	819	838	N/A	INTRINSIC
low complexity region	854	866	N/A	INTRINSIC
low complexity region	871	884	N/A	INTRINSIC
transmembrane domain	902	921	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185817

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187949

Meta Mutation Damage Score

0.0880

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.8%
20x: 90.8%

Validation Efficiency

100% (37/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene functions early in the glycosylphosphatidylinositol (GPI) biosynthetic pathway, catalyzing the inositol deacylation of GPI. The encoded protein is required for the production of GPI that can attach to proteins, and this may be an important factor in the transport of GPI-anchored proteins from the endoplasmic reticulum to the Golgi. Defects in this gene are a cause of mental retardation, autosomal recessive 42. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mutations in this gene result in a variety of forebrain, eye, jaw, craniofacial, ear, and vertebra defects that are background sensitive. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aebp1	A	G	11: 5,870,834	N542D	possibly damaging	Het
Ap2b1	T	A	11: 83,333,109	W217R	probably damaging	Het
Cep290	T	A	10: 100,539,100		probably benign	Het
Col27a1	G	A	4: 63,265,631		probably benign	Het
Cyp2d12	A	T	15: 82,557,686	H109L	probably benign	Het
Dnah17	T	C	11: 118,121,366		probably benign	Het
Gm6904	A	T	14: 59,258,547	H39Q	probably benign	Het
Golga3	G	A	5: 110,204,843	A867T	probably benign	Het
Gstt4	T	A	10: 75,817,299	N143I	possibly damaging	Het
Hdac2	G	A	10: 36,986,374	R78Q	possibly damaging	Het
Itsn2	T	C	12: 4,700,378	I1241T	probably damaging	Het
Kalrn	T	C	16: 34,016,498	K2249R	probably damaging	Het
Klrg1	T	A	6: 122,273,579	I138F	probably benign	Het
Mast1	A	G	8: 84,912,716	V1328A	probably benign	Het
Mettl25	T	C	10: 105,823,265	S386G	probably benign	Het
Nme2	A	T	11: 93,951,956	N210K	possibly damaging	Het
Pgk2	C	A	17: 40,208,364	V58L	probably benign	Het
Pou6f1	T	A	15: 100,578,305	T292S	probably damaging	Het
Rbm5	G	A	9: 107,744,242	R15C	probably damaging	Het
Rnf215	T	C	11: 4,139,806	V273A	possibly damaging	Het
Rras	A	G	7: 45,020,579	D145G	probably damaging	Het
Safb2	T	C	17: 56,584,265		probably benign	Het
Setdb1	A	T	3: 95,349,876		probably benign	Het
Sp5	A	G	2: 70,476,529	D186G	probably benign	Het
Thada	A	G	17: 84,252,435		probably benign	Het
Tle1	A	G	4: 72,124,838	V598A	probably damaging	Het
Tnrc6c	A	G	11: 117,733,703	N947S	possibly damaging	Het
Tnxb	T	C	17: 34,710,166	S2728P	probably damaging	Het
Vmn1r13	A	G	6: 57,210,407	R184G	probably damaging	Het
Wdr24	C	T	17: 25,827,348	T522I	possibly damaging	Het
Zfyve16	A	G	13: 92,522,332	V357A	probably benign	Het

Other mutations in Pgap1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00846:Pgap1	APN	1	54492021	splice site	probably benign
IGL01111:Pgap1	APN	1	54530943	missense	probably benign	0.17
IGL01406:Pgap1	APN	1	54533414	splice site	probably null
IGL01592:Pgap1	APN	1	54521311	missense	probably damaging	1.00
IGL02005:Pgap1	APN	1	54551055	missense	probably damaging	0.99
IGL02026:Pgap1	APN	1	54494819	missense	probably benign	0.05
IGL02086:Pgap1	APN	1	54547988	missense	probably damaging	1.00
IGL02354:Pgap1	APN	1	54512816	missense	probably benign	0.02
IGL02361:Pgap1	APN	1	54512816	missense	probably benign	0.02
IGL02995:Pgap1	APN	1	54493350	missense	probably benign	0.19
IGL03012:Pgap1	APN	1	54533413	splice site	probably benign
R0044:Pgap1	UTSW	1	54493368	missense	probably damaging	1.00
R0109:Pgap1	UTSW	1	54494825	missense	probably damaging	1.00
R0109:Pgap1	UTSW	1	54494825	missense	probably damaging	1.00
R0241:Pgap1	UTSW	1	54535951	splice site	probably null
R0241:Pgap1	UTSW	1	54535951	splice site	probably null
R0352:Pgap1	UTSW	1	54486458	splice site	probably benign
R1429:Pgap1	UTSW	1	54494861	missense	probably benign	0.01
R1465:Pgap1	UTSW	1	54528555	missense	probably benign	0.11
R1465:Pgap1	UTSW	1	54528555	missense	probably benign	0.11
R1542:Pgap1	UTSW	1	54492090	missense	probably benign	0.16
R1816:Pgap1	UTSW	1	54492057	missense	probably damaging	0.99
R1817:Pgap1	UTSW	1	54535969	missense	probably benign	0.15
R1905:Pgap1	UTSW	1	54511961	missense	probably benign	0.26
R2006:Pgap1	UTSW	1	54551061	missense	possibly damaging	0.76
R3551:Pgap1	UTSW	1	54530143	missense	possibly damaging	0.89
R3833:Pgap1	UTSW	1	54557465	missense	probably damaging	0.99
R3901:Pgap1	UTSW	1	54493348	missense	probably benign
R4487:Pgap1	UTSW	1	54528592	missense	probably benign	0.26
R4874:Pgap1	UTSW	1	54530137	missense	probably damaging	0.96
R5184:Pgap1	UTSW	1	54481856	missense	probably damaging	1.00
R6181:Pgap1	UTSW	1	54512777	missense	probably benign	0.05
R6212:Pgap1	UTSW	1	54514893	missense	probably damaging	0.99
R6269:Pgap1	UTSW	1	54548008	nonsense	probably null
R6525:Pgap1	UTSW	1	54481889	missense	probably benign	0.00
R6944:Pgap1	UTSW	1	54530161	missense	probably damaging	1.00
R7214:Pgap1	UTSW	1	54543061	missense	possibly damaging	0.47
R7256:Pgap1	UTSW	1	54493207	critical splice donor site	probably null
R7290:Pgap1	UTSW	1	54548066	missense	possibly damaging	0.45
R7356:Pgap1	UTSW	1	54530134	missense	probably benign	0.10
R7525:Pgap1	UTSW	1	54530922	missense	probably benign	0.26
R7602:Pgap1	UTSW	1	54543186	missense	probably damaging	1.00
R7897:Pgap1	UTSW	1	54551008	missense	probably damaging	1.00
R8278:Pgap1	UTSW	1	54490271	missense	probably benign
X0025:Pgap1	UTSW	1	54481870	missense	probably benign	0.26
X0060:Pgap1	UTSW	1	54536034	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACCGGGTTCATTGCCTGACAC -3'
(R):5'- ACAGACACTGATGCTTCCTGGACG -3'

Sequencing Primer
(F):5'- AGGATTCAAGTCTTCATCCCGAG -3'
(R):5'- tctaccactgagccaaatcc -3'

Posted On

2014-02-18