Incidental Mutation 'R1297:Vmn1r13'
ID158174
Institutional Source Beutler Lab
Gene Symbol Vmn1r13
Ensembl Gene ENSMUSG00000064259
Gene Namevomeronasal 1 receptor 13
SynonymsV1rc5
MMRRC Submission 039363-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R1297 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location57203290-57214799 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 57210407 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 184 (R184G)
Ref Sequence ENSEMBL: ENSMUSP00000154429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078885] [ENSMUST00000226892] [ENSMUST00000227298] [ENSMUST00000227421]
Predicted Effect probably damaging
Transcript: ENSMUST00000078885
AA Change: R184G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000077924
Gene: ENSMUSG00000064259
AA Change: R184G

DomainStartEndE-ValueType
Pfam:V1R 28 294 3.3e-58 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000226892
AA Change: R184G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000227298
AA Change: R184G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000227421
AA Change: R184G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.8%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp1 A G 11: 5,870,834 N542D possibly damaging Het
Ap2b1 T A 11: 83,333,109 W217R probably damaging Het
Cep290 T A 10: 100,539,100 probably benign Het
Col27a1 G A 4: 63,265,631 probably benign Het
Cyp2d12 A T 15: 82,557,686 H109L probably benign Het
Dnah17 T C 11: 118,121,366 probably benign Het
Gm6904 A T 14: 59,258,547 H39Q probably benign Het
Golga3 G A 5: 110,204,843 A867T probably benign Het
Gstt4 T A 10: 75,817,299 N143I possibly damaging Het
Hdac2 G A 10: 36,986,374 R78Q possibly damaging Het
Itsn2 T C 12: 4,700,378 I1241T probably damaging Het
Kalrn T C 16: 34,016,498 K2249R probably damaging Het
Klrg1 T A 6: 122,273,579 I138F probably benign Het
Mast1 A G 8: 84,912,716 V1328A probably benign Het
Mettl25 T C 10: 105,823,265 S386G probably benign Het
Nme2 A T 11: 93,951,956 N210K possibly damaging Het
Pgap1 T C 1: 54,528,523 S388G possibly damaging Het
Pgk2 C A 17: 40,208,364 V58L probably benign Het
Pou6f1 T A 15: 100,578,305 T292S probably damaging Het
Rbm5 G A 9: 107,744,242 R15C probably damaging Het
Rnf215 T C 11: 4,139,806 V273A possibly damaging Het
Rras A G 7: 45,020,579 D145G probably damaging Het
Safb2 T C 17: 56,584,265 probably benign Het
Setdb1 A T 3: 95,349,876 probably benign Het
Sp5 A G 2: 70,476,529 D186G probably benign Het
Thada A G 17: 84,252,435 probably benign Het
Tle1 A G 4: 72,124,838 V598A probably damaging Het
Tnrc6c A G 11: 117,733,703 N947S possibly damaging Het
Tnxb T C 17: 34,710,166 S2728P probably damaging Het
Wdr24 C T 17: 25,827,348 T522I possibly damaging Het
Zfyve16 A G 13: 92,522,332 V357A probably benign Het
Other mutations in Vmn1r13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00870:Vmn1r13 APN 6 57210113 missense probably benign 0.10
IGL01511:Vmn1r13 APN 6 57210329 missense probably benign 0.00
IGL02412:Vmn1r13 APN 6 57210489 missense possibly damaging 0.46
IGL02455:Vmn1r13 APN 6 57210472 missense probably damaging 1.00
IGL03046:Vmn1r13 APN 6 57210732 missense probably benign
R0285:Vmn1r13 UTSW 6 57209994 missense probably benign 0.06
R0304:Vmn1r13 UTSW 6 57210626 missense probably benign 0.01
R0385:Vmn1r13 UTSW 6 57210705 missense probably benign 0.06
R0402:Vmn1r13 UTSW 6 57210098 missense possibly damaging 0.96
R0544:Vmn1r13 UTSW 6 57210263 missense probably benign
R0960:Vmn1r13 UTSW 6 57210011 missense probably benign 0.06
R4056:Vmn1r13 UTSW 6 57209985 missense probably benign 0.03
R5108:Vmn1r13 UTSW 6 57209916 missense probably benign 0.33
R6388:Vmn1r13 UTSW 6 57209918 missense probably benign 0.01
R7136:Vmn1r13 UTSW 6 57210254 missense possibly damaging 0.93
R7204:Vmn1r13 UTSW 6 57210156 missense probably benign 0.13
R7239:Vmn1r13 UTSW 6 57210626 missense probably benign 0.01
R7303:Vmn1r13 UTSW 6 57210602 missense probably damaging 1.00
X0066:Vmn1r13 UTSW 6 57210597 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GCTGTCACAATCAGTCCGAGTACC -3'
(R):5'- TGGATGAGAGGATGAAGTCCACCC -3'

Sequencing Primer
(F):5'- AGTCCGAGTACCTCTATGCTGG -3'
(R):5'- GGATGAAGTCCACCCAGTACAAG -3'
Posted On2014-02-18