Incidental Mutation 'R1297:Klrg1'
ID158175
Institutional Source Beutler Lab
Gene Symbol Klrg1
Ensembl Gene ENSMUSG00000030114
Gene Namekiller cell lectin-like receptor subfamily G, member 1
Synonyms2F1-Ag
MMRRC Submission 039363-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1297 (G1)
Quality Score218
Status Validated
Chromosome6
Chromosomal Location122270596-122282882 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 122273579 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 138 (I138F)
Ref Sequence ENSEMBL: ENSMUSP00000032207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032207]
PDB Structure
Structure of NK cell receptor KLRG1 bound to E-cadherin [X-RAY DIFFRACTION]
Structure of NK cell receptor KLRG1 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000032207
AA Change: I138F

PolyPhen 2 Score 0.123 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000032207
Gene: ENSMUSG00000030114
AA Change: I138F

DomainStartEndE-ValueType
transmembrane domain 34 56 N/A INTRINSIC
CLECT 75 184 1.13e-18 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.8%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Natural killer (NK) cells are lymphocytes that can mediate lysis of certain tumor cells and virus-infected cells without previous activation. They can also regulate specific humoral and cell-mediated immunity. The protein encoded by this gene belongs to the killer cell lectin-like receptor (KLR) family, which is a group of transmembrane proteins preferentially expressed in NK cells. Studies in mice suggested that the expression of this gene may be regulated by MHC class I molecules. [provided by RefSeq, Jun 2016]
PHENOTYPE: Mice homozygous for a null allele have no abnormal phenoptype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp1 A G 11: 5,870,834 N542D possibly damaging Het
Ap2b1 T A 11: 83,333,109 W217R probably damaging Het
Cep290 T A 10: 100,539,100 probably benign Het
Col27a1 G A 4: 63,265,631 probably benign Het
Cyp2d12 A T 15: 82,557,686 H109L probably benign Het
Dnah17 T C 11: 118,121,366 probably benign Het
Gm6904 A T 14: 59,258,547 H39Q probably benign Het
Golga3 G A 5: 110,204,843 A867T probably benign Het
Gstt4 T A 10: 75,817,299 N143I possibly damaging Het
Hdac2 G A 10: 36,986,374 R78Q possibly damaging Het
Itsn2 T C 12: 4,700,378 I1241T probably damaging Het
Kalrn T C 16: 34,016,498 K2249R probably damaging Het
Mast1 A G 8: 84,912,716 V1328A probably benign Het
Mettl25 T C 10: 105,823,265 S386G probably benign Het
Nme2 A T 11: 93,951,956 N210K possibly damaging Het
Pgap1 T C 1: 54,528,523 S388G possibly damaging Het
Pgk2 C A 17: 40,208,364 V58L probably benign Het
Pou6f1 T A 15: 100,578,305 T292S probably damaging Het
Rbm5 G A 9: 107,744,242 R15C probably damaging Het
Rnf215 T C 11: 4,139,806 V273A possibly damaging Het
Rras A G 7: 45,020,579 D145G probably damaging Het
Safb2 T C 17: 56,584,265 probably benign Het
Setdb1 A T 3: 95,349,876 probably benign Het
Sp5 A G 2: 70,476,529 D186G probably benign Het
Thada A G 17: 84,252,435 probably benign Het
Tle1 A G 4: 72,124,838 V598A probably damaging Het
Tnrc6c A G 11: 117,733,703 N947S possibly damaging Het
Tnxb T C 17: 34,710,166 S2728P probably damaging Het
Vmn1r13 A G 6: 57,210,407 R184G probably damaging Het
Wdr24 C T 17: 25,827,348 T522I possibly damaging Het
Zfyve16 A G 13: 92,522,332 V357A probably benign Het
Other mutations in Klrg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Klrg1 APN 6 122282752 missense probably benign 0.00
R0766:Klrg1 UTSW 6 122279663 missense probably benign 0.00
R1974:Klrg1 UTSW 6 122282762 missense possibly damaging 0.74
R2034:Klrg1 UTSW 6 122279637 critical splice donor site probably null
R4823:Klrg1 UTSW 6 122273533 splice site probably null
R4995:Klrg1 UTSW 6 122278275 missense probably benign 0.00
R5029:Klrg1 UTSW 6 122282735 missense probably benign
R5225:Klrg1 UTSW 6 122271372 makesense probably null
R6389:Klrg1 UTSW 6 122271472 missense probably damaging 0.96
R6482:Klrg1 UTSW 6 122271453 nonsense probably null
R7958:Klrg1 UTSW 6 122271372 makesense probably null
Predicted Primers PCR Primer
(F):5'- CCAGGGACTACTCAATCAGGAAGGAC -3'
(R):5'- gagagagagagagagagGATAAGGATGACTAA -3'

Sequencing Primer
(F):5'- cccccaccctcacctcc -3'
(R):5'- tcccccataccctcccc -3'
Posted On2014-02-18