Incidental Mutation 'R1297:Rras'
ID158176
Institutional Source Beutler Lab
Gene Symbol Rras
Ensembl Gene ENSMUSG00000038387
Gene Namerelated RAS viral (r-ras) oncogene
Synonyms
MMRRC Submission 039363-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1297 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location45017961-45021647 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45020579 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 145 (D145G)
Ref Sequence ENSEMBL: ENSMUSP00000042150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044111] [ENSMUST00000085383] [ENSMUST00000210895] [ENSMUST00000211680]
Predicted Effect probably damaging
Transcript: ENSMUST00000044111
AA Change: D145G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042150
Gene: ENSMUSG00000038387
AA Change: D145G

DomainStartEndE-ValueType
RAS 27 193 2.25e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000085383
SMART Domains Protein: ENSMUSP00000082501
Gene: ENSMUSG00000038406

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
low complexity region 59 78 N/A INTRINSIC
low complexity region 83 95 N/A INTRINSIC
low complexity region 185 224 N/A INTRINSIC
coiled coil region 269 295 N/A INTRINSIC
low complexity region 367 379 N/A INTRINSIC
low complexity region 382 396 N/A INTRINSIC
low complexity region 411 435 N/A INTRINSIC
low complexity region 488 511 N/A INTRINSIC
low complexity region 534 618 N/A INTRINSIC
low complexity region 631 641 N/A INTRINSIC
low complexity region 669 685 N/A INTRINSIC
low complexity region 703 726 N/A INTRINSIC
low complexity region 730 739 N/A INTRINSIC
low complexity region 752 775 N/A INTRINSIC
Blast:IG_like 776 833 6e-6 BLAST
low complexity region 843 873 N/A INTRINSIC
low complexity region 876 888 N/A INTRINSIC
low complexity region 917 937 N/A INTRINSIC
coiled coil region 963 983 N/A INTRINSIC
low complexity region 1025 1037 N/A INTRINSIC
low complexity region 1098 1128 N/A INTRINSIC
low complexity region 1136 1146 N/A INTRINSIC
Blast:IG_like 1151 1194 2e-16 BLAST
low complexity region 1225 1256 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210056
Predicted Effect probably benign
Transcript: ENSMUST00000210397
Predicted Effect probably benign
Transcript: ENSMUST00000210895
Predicted Effect probably benign
Transcript: ENSMUST00000211680
Meta Mutation Damage Score 0.9682 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.8%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a small GTPase involved in diverse processes including angiogenesis, vascular homeostasis and regeneration, cell adhesion, and neuronal axon guidance. Mutations in this gene are found in many invasive cancers. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a gene-trapped allele exhibit enhanced neointimal thickening in response to arterial injury, increased angiogenesis in matrigel plugs and aortic ring cultures, and increased neovascularization of tumor implants, and decreased B-cell and increased T-cell population percentages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp1 A G 11: 5,870,834 N542D possibly damaging Het
Ap2b1 T A 11: 83,333,109 W217R probably damaging Het
Cep290 T A 10: 100,539,100 probably benign Het
Col27a1 G A 4: 63,265,631 probably benign Het
Cyp2d12 A T 15: 82,557,686 H109L probably benign Het
Dnah17 T C 11: 118,121,366 probably benign Het
Gm6904 A T 14: 59,258,547 H39Q probably benign Het
Golga3 G A 5: 110,204,843 A867T probably benign Het
Gstt4 T A 10: 75,817,299 N143I possibly damaging Het
Hdac2 G A 10: 36,986,374 R78Q possibly damaging Het
Itsn2 T C 12: 4,700,378 I1241T probably damaging Het
Kalrn T C 16: 34,016,498 K2249R probably damaging Het
Klrg1 T A 6: 122,273,579 I138F probably benign Het
Mast1 A G 8: 84,912,716 V1328A probably benign Het
Mettl25 T C 10: 105,823,265 S386G probably benign Het
Nme2 A T 11: 93,951,956 N210K possibly damaging Het
Pgap1 T C 1: 54,528,523 S388G possibly damaging Het
Pgk2 C A 17: 40,208,364 V58L probably benign Het
Pou6f1 T A 15: 100,578,305 T292S probably damaging Het
Rbm5 G A 9: 107,744,242 R15C probably damaging Het
Rnf215 T C 11: 4,139,806 V273A possibly damaging Het
Safb2 T C 17: 56,584,265 probably benign Het
Setdb1 A T 3: 95,349,876 probably benign Het
Sp5 A G 2: 70,476,529 D186G probably benign Het
Thada A G 17: 84,252,435 probably benign Het
Tle1 A G 4: 72,124,838 V598A probably damaging Het
Tnrc6c A G 11: 117,733,703 N947S possibly damaging Het
Tnxb T C 17: 34,710,166 S2728P probably damaging Het
Vmn1r13 A G 6: 57,210,407 R184G probably damaging Het
Wdr24 C T 17: 25,827,348 T522I possibly damaging Het
Zfyve16 A G 13: 92,522,332 V357A probably benign Het
Other mutations in Rras
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Rras APN 7 45021285 missense possibly damaging 0.89
R0553:Rras UTSW 7 45020556 missense probably benign 0.00
R2495:Rras UTSW 7 45018064 missense probably damaging 1.00
R4419:Rras UTSW 7 45020579 missense probably damaging 1.00
R5833:Rras UTSW 7 45021291 missense possibly damaging 0.72
R6042:Rras UTSW 7 45020396 missense probably damaging 0.97
R6291:Rras UTSW 7 45018171 splice site probably null
R7542:Rras UTSW 7 45020342 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCCATTAACGACAGGCAGAGG -3'
(R):5'- TCAGGACAGGGGAACCAGTATCAAC -3'

Sequencing Primer
(F):5'- AGGTGAGGGGGATGCTG -3'
(R):5'- tggttagaatccctcagtgatg -3'
Posted On2014-02-18