Incidental Mutation 'R1297:Mast1'
ID 158177
Institutional Source Beutler Lab
Gene Symbol Mast1
Ensembl Gene ENSMUSG00000053693
Gene Name microtubule associated serine/threonine kinase 1
Synonyms 9430008B02Rik, SAST, SAST170
MMRRC Submission 039363-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1297 (G1)
Quality Score 199
Status Validated
Chromosome 8
Chromosomal Location 85638532-85663988 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 85639345 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1328 (V1328A)
Ref Sequence ENSEMBL: ENSMUSP00000105363 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003910] [ENSMUST00000109741] [ENSMUST00000109744] [ENSMUST00000119820] [ENSMUST00000134569] [ENSMUST00000145292]
AlphaFold Q9R1L5
Predicted Effect probably benign
Transcript: ENSMUST00000003910
SMART Domains Protein: ENSMUSP00000003910
Gene: ENSMUSG00000003812

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:DNase_II 21 349 5.8e-116 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109741
AA Change: V1328A

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000105363
Gene: ENSMUSG00000053693
AA Change: V1328A

DomainStartEndE-ValueType
Pfam:DUF1908 61 337 1.4e-136 PFAM
S_TKc 376 649 4.07e-97 SMART
S_TK_X 650 710 6.23e-2 SMART
low complexity region 820 836 N/A INTRINSIC
low complexity region 863 878 N/A INTRINSIC
low complexity region 933 961 N/A INTRINSIC
PDZ 977 1057 3.49e-14 SMART
low complexity region 1104 1132 N/A INTRINSIC
low complexity region 1149 1174 N/A INTRINSIC
low complexity region 1212 1224 N/A INTRINSIC
low complexity region 1243 1252 N/A INTRINSIC
low complexity region 1479 1492 N/A INTRINSIC
low complexity region 1519 1535 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109744
SMART Domains Protein: ENSMUSP00000105366
Gene: ENSMUSG00000003812

DomainStartEndE-ValueType
Pfam:DNase_II 9 328 4.8e-114 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119820
SMART Domains Protein: ENSMUSP00000113547
Gene: ENSMUSG00000053693

DomainStartEndE-ValueType
Pfam:DUF1908 61 338 5.1e-148 PFAM
S_TKc 376 644 2.79e-86 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128400
Predicted Effect probably benign
Transcript: ENSMUST00000134569
SMART Domains Protein: ENSMUSP00000117198
Gene: ENSMUSG00000003812

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:DNase_II 20 119 6.6e-32 PFAM
Pfam:DNase_II 115 182 4.3e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135219
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153215
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148573
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153000
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155942
Predicted Effect probably benign
Transcript: ENSMUST00000145292
SMART Domains Protein: ENSMUSP00000138203
Gene: ENSMUSG00000003812

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:DNase_II 20 97 2.4e-21 PFAM
Meta Mutation Damage Score 0.0582 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.8%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp1 A G 11: 5,820,834 (GRCm39) N542D possibly damaging Het
Ap2b1 T A 11: 83,223,935 (GRCm39) W217R probably damaging Het
Cep290 T A 10: 100,374,962 (GRCm39) probably benign Het
Col27a1 G A 4: 63,183,868 (GRCm39) probably benign Het
Cyp2d12 A T 15: 82,441,887 (GRCm39) H109L probably benign Het
Dnah17 T C 11: 118,012,192 (GRCm39) probably benign Het
Golga3 G A 5: 110,352,709 (GRCm39) A867T probably benign Het
Gstt4 T A 10: 75,653,133 (GRCm39) N143I possibly damaging Het
Hdac2 G A 10: 36,862,370 (GRCm39) R78Q possibly damaging Het
Itsn2 T C 12: 4,750,378 (GRCm39) I1241T probably damaging Het
Kalrn T C 16: 33,836,868 (GRCm39) K2249R probably damaging Het
Klrg1 T A 6: 122,250,538 (GRCm39) I138F probably benign Het
Mettl25 T C 10: 105,659,126 (GRCm39) S386G probably benign Het
Nme2 A T 11: 93,842,782 (GRCm39) N210K possibly damaging Het
Pgap1 T C 1: 54,567,682 (GRCm39) S388G possibly damaging Het
Pgk2 C A 17: 40,519,255 (GRCm39) V58L probably benign Het
Phf11 A T 14: 59,495,996 (GRCm39) H39Q probably benign Het
Pou6f1 T A 15: 100,476,186 (GRCm39) T292S probably damaging Het
Rbm5 G A 9: 107,621,441 (GRCm39) R15C probably damaging Het
Rnf215 T C 11: 4,089,806 (GRCm39) V273A possibly damaging Het
Rras A G 7: 44,670,003 (GRCm39) D145G probably damaging Het
Safb2 T C 17: 56,891,265 (GRCm39) probably benign Het
Setdb1 A T 3: 95,257,187 (GRCm39) probably benign Het
Sp5 A G 2: 70,306,873 (GRCm39) D186G probably benign Het
Thada A G 17: 84,559,863 (GRCm39) probably benign Het
Tle1 A G 4: 72,043,075 (GRCm39) V598A probably damaging Het
Tnrc6c A G 11: 117,624,529 (GRCm39) N947S possibly damaging Het
Tnxb T C 17: 34,929,140 (GRCm39) S2728P probably damaging Het
Vmn1r13 A G 6: 57,187,392 (GRCm39) R184G probably damaging Het
Wdr24 C T 17: 26,046,322 (GRCm39) T522I possibly damaging Het
Zfyve16 A G 13: 92,658,840 (GRCm39) V357A probably benign Het
Other mutations in Mast1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01395:Mast1 APN 8 85,639,444 (GRCm39) missense possibly damaging 0.87
IGL01862:Mast1 APN 8 85,639,875 (GRCm39) splice site probably null
IGL01918:Mast1 APN 8 85,647,838 (GRCm39) missense probably damaging 1.00
IGL02212:Mast1 APN 8 85,648,026 (GRCm39) missense probably damaging 1.00
IGL02221:Mast1 APN 8 85,645,384 (GRCm39) missense possibly damaging 0.92
IGL02370:Mast1 APN 8 85,638,883 (GRCm39) missense probably benign
IGL02470:Mast1 APN 8 85,647,841 (GRCm39) missense probably damaging 1.00
IGL02596:Mast1 APN 8 85,644,400 (GRCm39) missense probably benign
IGL02716:Mast1 APN 8 85,662,352 (GRCm39) missense probably damaging 1.00
IGL02987:Mast1 APN 8 85,652,348 (GRCm39) missense possibly damaging 0.75
IGL03287:Mast1 APN 8 85,639,982 (GRCm39) missense probably benign 0.01
R0255:Mast1 UTSW 8 85,638,650 (GRCm39) missense probably benign
R0388:Mast1 UTSW 8 85,642,166 (GRCm39) missense probably benign 0.13
R0480:Mast1 UTSW 8 85,639,718 (GRCm39) missense probably damaging 0.99
R0727:Mast1 UTSW 8 85,648,044 (GRCm39) missense probably damaging 1.00
R1175:Mast1 UTSW 8 85,651,956 (GRCm39) missense probably benign 0.29
R1328:Mast1 UTSW 8 85,644,617 (GRCm39) intron probably benign
R1454:Mast1 UTSW 8 85,647,264 (GRCm39) missense probably damaging 1.00
R1532:Mast1 UTSW 8 85,655,238 (GRCm39) nonsense probably null
R1752:Mast1 UTSW 8 85,651,965 (GRCm39) missense probably benign
R1777:Mast1 UTSW 8 85,638,697 (GRCm39) missense probably benign
R1905:Mast1 UTSW 8 85,642,895 (GRCm39) missense probably damaging 1.00
R1906:Mast1 UTSW 8 85,642,895 (GRCm39) missense probably damaging 1.00
R1907:Mast1 UTSW 8 85,642,895 (GRCm39) missense probably damaging 1.00
R2056:Mast1 UTSW 8 85,646,995 (GRCm39) missense possibly damaging 0.95
R2071:Mast1 UTSW 8 85,647,823 (GRCm39) missense probably damaging 1.00
R2145:Mast1 UTSW 8 85,648,107 (GRCm39) missense probably damaging 1.00
R2318:Mast1 UTSW 8 85,647,754 (GRCm39) missense probably damaging 1.00
R2842:Mast1 UTSW 8 85,650,537 (GRCm39) missense probably damaging 1.00
R3870:Mast1 UTSW 8 85,645,360 (GRCm39) missense probably damaging 1.00
R3895:Mast1 UTSW 8 85,662,352 (GRCm39) missense probably damaging 1.00
R3973:Mast1 UTSW 8 85,645,393 (GRCm39) missense probably damaging 1.00
R4405:Mast1 UTSW 8 85,647,520 (GRCm39) missense probably damaging 1.00
R4533:Mast1 UTSW 8 85,647,990 (GRCm39) missense probably damaging 1.00
R4725:Mast1 UTSW 8 85,655,635 (GRCm39) missense possibly damaging 0.93
R4770:Mast1 UTSW 8 85,655,875 (GRCm39) missense probably benign 0.02
R4776:Mast1 UTSW 8 85,663,822 (GRCm39) critical splice donor site probably null
R4835:Mast1 UTSW 8 85,650,408 (GRCm39) missense probably damaging 1.00
R4871:Mast1 UTSW 8 85,647,287 (GRCm39) missense probably damaging 1.00
R4953:Mast1 UTSW 8 85,645,357 (GRCm39) missense probably damaging 0.99
R4960:Mast1 UTSW 8 85,644,500 (GRCm39) missense probably benign
R4978:Mast1 UTSW 8 85,662,416 (GRCm39) missense probably damaging 0.98
R5164:Mast1 UTSW 8 85,640,147 (GRCm39) unclassified probably benign
R5235:Mast1 UTSW 8 85,640,068 (GRCm39) missense probably damaging 1.00
R5297:Mast1 UTSW 8 85,639,947 (GRCm39) critical splice donor site probably null
R5463:Mast1 UTSW 8 85,652,136 (GRCm39) missense probably damaging 1.00
R5546:Mast1 UTSW 8 85,642,889 (GRCm39) missense probably damaging 1.00
R5651:Mast1 UTSW 8 85,655,597 (GRCm39) nonsense probably null
R6124:Mast1 UTSW 8 85,651,936 (GRCm39) missense probably benign 0.01
R6213:Mast1 UTSW 8 85,642,198 (GRCm39) missense probably damaging 1.00
R6717:Mast1 UTSW 8 85,644,383 (GRCm39) missense probably benign
R7000:Mast1 UTSW 8 85,655,598 (GRCm39) missense probably damaging 1.00
R7011:Mast1 UTSW 8 85,638,574 (GRCm39) nonsense probably null
R7164:Mast1 UTSW 8 85,661,933 (GRCm39) missense possibly damaging 0.81
R7695:Mast1 UTSW 8 85,647,557 (GRCm39) missense probably damaging 1.00
R7845:Mast1 UTSW 8 85,651,954 (GRCm39) nonsense probably null
R7882:Mast1 UTSW 8 85,639,947 (GRCm39) critical splice donor site probably null
R8167:Mast1 UTSW 8 85,647,987 (GRCm39) missense probably damaging 1.00
R8197:Mast1 UTSW 8 85,639,450 (GRCm39) missense possibly damaging 0.90
R8773:Mast1 UTSW 8 85,642,953 (GRCm39) missense probably damaging 1.00
R9477:Mast1 UTSW 8 85,638,779 (GRCm39) missense probably benign 0.18
R9526:Mast1 UTSW 8 85,647,805 (GRCm39) missense probably damaging 1.00
R9557:Mast1 UTSW 8 85,657,474 (GRCm39) missense probably damaging 1.00
R9655:Mast1 UTSW 8 85,650,660 (GRCm39) missense probably damaging 1.00
X0066:Mast1 UTSW 8 85,647,507 (GRCm39) missense probably damaging 1.00
Z1176:Mast1 UTSW 8 85,645,310 (GRCm39) missense probably damaging 1.00
Z1176:Mast1 UTSW 8 85,639,088 (GRCm39) missense probably damaging 0.97
Z1177:Mast1 UTSW 8 85,647,075 (GRCm39) missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CTCATGTTCCTGCACTGGACTTAGC -3'
(R):5'- AGCTTCCAGCACGCCTAATTCC -3'

Sequencing Primer
(F):5'- TGTGCAACCCGAGTCAC -3'
(R):5'- GGGCTGTCACCGAAACTAC -3'
Posted On 2014-02-18