Incidental Mutation 'R1297:Nme2'
ID158186
Institutional Source Beutler Lab
Gene Symbol Nme2
Ensembl Gene ENSMUSG00000020857
Gene NameNME/NM23 nucleoside diphosphate kinase 2
SynonymsNM23-H2, non-metastatic cells 2, protein (NM23B) expressed in, nm23-M2
MMRRC Submission 039363-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1297 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location93949814-93956259 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 93951956 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 210 (N210K)
Ref Sequence ENSEMBL: ENSMUSP00000132590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021217] [ENSMUST00000072566] [ENSMUST00000107853] [ENSMUST00000107854] [ENSMUST00000170303]
Predicted Effect probably benign
Transcript: ENSMUST00000021217
AA Change: N95K

PolyPhen 2 Score 0.369 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000021217
Gene: ENSMUSG00000020857
AA Change: N95K

DomainStartEndE-ValueType
NDK 4 141 2.8e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000072566
AA Change: N95K

PolyPhen 2 Score 0.369 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000103476
Gene: ENSMUSG00000020857
AA Change: N95K

DomainStartEndE-ValueType
NDK 4 141 2.8e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107853
SMART Domains Protein: ENSMUSP00000103485
Gene: ENSMUSG00000059474

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
PDB:2W0T|A 52 74 1e-6 PDB
low complexity region 75 90 N/A INTRINSIC
low complexity region 114 130 N/A INTRINSIC
MBT 144 248 1.2e-24 SMART
MBT 256 357 4.8e-44 SMART
MBT 361 459 6.1e-41 SMART
MBT 467 563 1.6e-56 SMART
low complexity region 564 592 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107854
SMART Domains Protein: ENSMUSP00000103486
Gene: ENSMUSG00000059474

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
PDB:2W0T|A 52 74 1e-6 PDB
low complexity region 75 90 N/A INTRINSIC
low complexity region 114 130 N/A INTRINSIC
MBT 144 248 1.2e-24 SMART
MBT 256 357 4.9e-44 SMART
MBT 361 459 6.2e-41 SMART
MBT 467 563 1.6e-56 SMART
low complexity region 564 592 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000170303
AA Change: N210K

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000132590
Gene: ENSMUSG00000091228
AA Change: N210K

DomainStartEndE-ValueType
NDK 4 118 7.56e-55 SMART
NDK 119 256 2.8e-90 SMART
Meta Mutation Damage Score 0.3931 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.8%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nucleoside diphosphate kinase (NDK) exists as a hexamer composed of 'A' (encoded by NME1) and 'B' (encoded by this gene) isoforms. Multiple alternatively spliced transcript variants have been found for this gene. Read-through transcription from the neighboring upstream gene (NME1) generates naturally-occurring transcripts (NME1-NME2) that encode a fusion protein comprised of sequence sharing identity with each individual gene product. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit impaired Th1 and Th2 cell KCa3.1 channel activity and TCR-stimulated calcium ion flux and cytokine production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp1 A G 11: 5,870,834 N542D possibly damaging Het
Ap2b1 T A 11: 83,333,109 W217R probably damaging Het
Cep290 T A 10: 100,539,100 probably benign Het
Col27a1 G A 4: 63,265,631 probably benign Het
Cyp2d12 A T 15: 82,557,686 H109L probably benign Het
Dnah17 T C 11: 118,121,366 probably benign Het
Gm6904 A T 14: 59,258,547 H39Q probably benign Het
Golga3 G A 5: 110,204,843 A867T probably benign Het
Gstt4 T A 10: 75,817,299 N143I possibly damaging Het
Hdac2 G A 10: 36,986,374 R78Q possibly damaging Het
Itsn2 T C 12: 4,700,378 I1241T probably damaging Het
Kalrn T C 16: 34,016,498 K2249R probably damaging Het
Klrg1 T A 6: 122,273,579 I138F probably benign Het
Mast1 A G 8: 84,912,716 V1328A probably benign Het
Mettl25 T C 10: 105,823,265 S386G probably benign Het
Pgap1 T C 1: 54,528,523 S388G possibly damaging Het
Pgk2 C A 17: 40,208,364 V58L probably benign Het
Pou6f1 T A 15: 100,578,305 T292S probably damaging Het
Rbm5 G A 9: 107,744,242 R15C probably damaging Het
Rnf215 T C 11: 4,139,806 V273A possibly damaging Het
Rras A G 7: 45,020,579 D145G probably damaging Het
Safb2 T C 17: 56,584,265 probably benign Het
Setdb1 A T 3: 95,349,876 probably benign Het
Sp5 A G 2: 70,476,529 D186G probably benign Het
Thada A G 17: 84,252,435 probably benign Het
Tle1 A G 4: 72,124,838 V598A probably damaging Het
Tnrc6c A G 11: 117,733,703 N947S possibly damaging Het
Tnxb T C 17: 34,710,166 S2728P probably damaging Het
Vmn1r13 A G 6: 57,210,407 R184G probably damaging Het
Wdr24 C T 17: 25,827,348 T522I possibly damaging Het
Zfyve16 A G 13: 92,522,332 V357A probably benign Het
Other mutations in Nme2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0040:Nme2 UTSW 11 93951930 splice site probably null
R3838:Nme2 UTSW 11 93949977 missense probably benign 0.00
R4612:Nme2 UTSW 11 93955602 missense possibly damaging 0.91
R7055:Nme2 UTSW 11 93955590 missense probably damaging 0.98
R7158:Nme2 UTSW 11 93955658 intron probably benign
Predicted Primers PCR Primer
(F):5'- TCCAAACCTTGGGATATGCCCAAAG -3'
(R):5'- GCAAGGAAAATTGTCTCGGAGCAC -3'

Sequencing Primer
(F):5'- GCCCAAAGTGTTATATATGCCAC -3'
(R):5'- TTAAAACAGGCTCTTGCTCTCAG -3'
Posted On2014-02-18