Incidental Mutation 'R1297:Pgk2'
ID158197
Institutional Source Beutler Lab
Gene Symbol Pgk2
Ensembl Gene ENSMUSG00000031233
Gene Namephosphoglycerate kinase 2
SynonymsTcp-2, Tcp-2, Pgk-2
MMRRC Submission 039363-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R1297 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location40207018-40208609 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 40208364 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 58 (V58L)
Ref Sequence ENSEMBL: ENSMUSP00000033585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033585]
PDB Structure
Crystal Structure of Phosphoglycerate Kinase-2 [X-RAY DIFFRACTION]
Crystal Structure of Phosphoglycerate Kinase-2 bound to 3-phosphoglycerate [X-RAY DIFFRACTION]
Crystal structure of phosphoglycerate kinase-2 bound to atp and 3pg [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000033585
AA Change: V58L

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000033585
Gene: ENSMUSG00000031233
AA Change: V58L

DomainStartEndE-ValueType
Pfam:PGK 9 406 1.3e-152 PFAM
Meta Mutation Damage Score 0.3627 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.8%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is intronless, arose via retrotransposition of the phosphoglycerate kinase 1 gene, and is expressed specifically in the testis. Initially assumed to be a pseudogene, the encoded protein is actually a functional phosphoglycerate kinase that catalyzes the reversible conversion of 1,3-bisphosphoglycerate to 3-phosphoglycerate, during the Embden-Meyerhof-Parnas pathway of glycolysis, in the later stages of spermatogenesis.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased male fertility associated with reduced sperm motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp1 A G 11: 5,870,834 N542D possibly damaging Het
Ap2b1 T A 11: 83,333,109 W217R probably damaging Het
Cep290 T A 10: 100,539,100 probably benign Het
Col27a1 G A 4: 63,265,631 probably benign Het
Cyp2d12 A T 15: 82,557,686 H109L probably benign Het
Dnah17 T C 11: 118,121,366 probably benign Het
Gm6904 A T 14: 59,258,547 H39Q probably benign Het
Golga3 G A 5: 110,204,843 A867T probably benign Het
Gstt4 T A 10: 75,817,299 N143I possibly damaging Het
Hdac2 G A 10: 36,986,374 R78Q possibly damaging Het
Itsn2 T C 12: 4,700,378 I1241T probably damaging Het
Kalrn T C 16: 34,016,498 K2249R probably damaging Het
Klrg1 T A 6: 122,273,579 I138F probably benign Het
Mast1 A G 8: 84,912,716 V1328A probably benign Het
Mettl25 T C 10: 105,823,265 S386G probably benign Het
Nme2 A T 11: 93,951,956 N210K possibly damaging Het
Pgap1 T C 1: 54,528,523 S388G possibly damaging Het
Pou6f1 T A 15: 100,578,305 T292S probably damaging Het
Rbm5 G A 9: 107,744,242 R15C probably damaging Het
Rnf215 T C 11: 4,139,806 V273A possibly damaging Het
Rras A G 7: 45,020,579 D145G probably damaging Het
Safb2 T C 17: 56,584,265 probably benign Het
Setdb1 A T 3: 95,349,876 probably benign Het
Sp5 A G 2: 70,476,529 D186G probably benign Het
Thada A G 17: 84,252,435 probably benign Het
Tle1 A G 4: 72,124,838 V598A probably damaging Het
Tnrc6c A G 11: 117,733,703 N947S possibly damaging Het
Tnxb T C 17: 34,710,166 S2728P probably damaging Het
Vmn1r13 A G 6: 57,210,407 R184G probably damaging Het
Wdr24 C T 17: 25,827,348 T522I possibly damaging Het
Zfyve16 A G 13: 92,522,332 V357A probably benign Het
Other mutations in Pgk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0195:Pgk2 UTSW 17 40207731 missense probably benign 0.01
R1351:Pgk2 UTSW 17 40207800 missense probably damaging 1.00
R1781:Pgk2 UTSW 17 40208507 missense probably benign 0.20
R2126:Pgk2 UTSW 17 40207509 missense probably damaging 1.00
R3153:Pgk2 UTSW 17 40208243 missense probably damaging 0.99
R3154:Pgk2 UTSW 17 40208243 missense probably damaging 0.99
R4152:Pgk2 UTSW 17 40208258 missense probably damaging 1.00
R4153:Pgk2 UTSW 17 40208258 missense probably damaging 1.00
R4154:Pgk2 UTSW 17 40208258 missense probably damaging 1.00
R4259:Pgk2 UTSW 17 40207383 missense probably benign 0.01
R4261:Pgk2 UTSW 17 40207383 missense probably benign 0.01
R4812:Pgk2 UTSW 17 40207390 missense possibly damaging 0.56
R4961:Pgk2 UTSW 17 40207521 missense probably damaging 1.00
R4989:Pgk2 UTSW 17 40207511 missense probably damaging 1.00
R5661:Pgk2 UTSW 17 40207396 nonsense probably null
R6246:Pgk2 UTSW 17 40207424 missense probably damaging 1.00
R6415:Pgk2 UTSW 17 40207568 missense probably benign 0.00
R7054:Pgk2 UTSW 17 40208475 missense probably benign 0.08
R7721:Pgk2 UTSW 17 40207518 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- GCTTCTACTTTAGCAGGGTCAGCAC -3'
(R):5'- CTTTGAACTCACAAAGAAAGGCGGG -3'

Sequencing Primer
(F):5'- CTTTAGCAGGGTCAGCACTAATC -3'
(R):5'- GTGCATACCATCAAGATGGCTC -3'
Posted On2014-02-18