Incidental Mutation 'R1298:Olfr1120'
ID158201
Institutional Source Beutler Lab
Gene Symbol Olfr1120
Ensembl Gene ENSMUSG00000081234
Gene Nameolfactory receptor 1120
SynonymsMOR264-2, GA_x6K02T2Q125-48849180-48850100
MMRRC Submission 039364-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.252) question?
Stock #R1298 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location87354815-87361786 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 87358070 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 209 (A209T)
Ref Sequence ENSEMBL: ENSMUSP00000149911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058737] [ENSMUST00000215163]
Predicted Effect probably benign
Transcript: ENSMUST00000058737
AA Change: A209T

PolyPhen 2 Score 0.196 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000051931
Gene: ENSMUSG00000081234
AA Change: A209T

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 1.1e-54 PFAM
Pfam:7tm_1 47 296 7.2e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215163
AA Change: A209T

PolyPhen 2 Score 0.196 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215282
Meta Mutation Damage Score 0.2416 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.1%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox5 A G 6: 116,427,264 W145R probably damaging Het
Aspm T A 1: 139,457,419 V267D probably benign Het
Bbs4 A T 9: 59,339,813 W135R probably damaging Het
Cavin4 T C 4: 48,672,593 V346A probably benign Het
Cdk18 A C 1: 132,122,451 probably benign Het
Cyp2j11 C T 4: 96,307,260 probably null Het
Dnah6 A T 6: 73,159,135 I1007K probably damaging Het
Dnmt1 T C 9: 20,941,456 E118G probably benign Het
Eef2 C CN 10: 81,178,768 probably null Het
Gm14496 T C 2: 181,996,092 F320L probably benign Het
Gm2046 T A 12: 87,980,083 D98E probably benign Het
Gsdmc3 A T 15: 63,860,281 L299M probably damaging Het
H6pd T C 4: 149,982,514 I472V probably benign Het
Hao2 G T 3: 98,883,669 T63K possibly damaging Het
Jag2 C T 12: 112,916,319 probably benign Het
Mapre3 A G 5: 30,864,867 Y211C probably damaging Het
Mycbp2 A G 14: 103,155,898 S2966P probably damaging Het
Nsd3 T A 8: 25,679,936 V696E possibly damaging Het
Obscn A G 11: 59,054,897 Y4163H possibly damaging Het
Olfr747 A T 14: 50,680,880 Y251* probably null Het
Olfr788 G T 10: 129,473,064 C124F probably damaging Het
Pde2a A G 7: 101,507,202 E607G probably benign Het
Pinlyp T A 7: 24,544,966 D51V probably damaging Het
Rcbtb2 T A 14: 73,162,388 I87N probably damaging Het
Sfswap A G 5: 129,541,378 I459V probably benign Het
Slitrk6 T C 14: 110,751,865 N137D possibly damaging Het
Smg1 A T 7: 118,168,211 probably benign Het
Sobp T A 10: 43,022,335 H418L probably damaging Het
Spock1 A C 13: 57,512,750 D180E probably benign Het
Upk3a G A 15: 85,020,551 V167I probably benign Het
Vmn1r180 T C 7: 23,953,147 V245A possibly damaging Het
Zbtb25 T C 12: 76,350,001 E149G probably benign Het
Zgrf1 T C 3: 127,583,889 C44R possibly damaging Het
Other mutations in Olfr1120
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01142:Olfr1120 APN 2 87357545 missense possibly damaging 0.82
IGL01680:Olfr1120 APN 2 87357905 missense probably damaging 1.00
IGL02210:Olfr1120 APN 2 87358003 missense probably damaging 1.00
R0624:Olfr1120 UTSW 2 87357682 nonsense probably null
R0849:Olfr1120 UTSW 2 87358265 missense probably benign 0.00
R2309:Olfr1120 UTSW 2 87357954 missense probably damaging 1.00
R4237:Olfr1120 UTSW 2 87358253 missense probably damaging 1.00
R4291:Olfr1120 UTSW 2 87358075 missense probably benign 0.00
R5679:Olfr1120 UTSW 2 87357545 missense possibly damaging 0.82
R5939:Olfr1120 UTSW 2 87357704 missense possibly damaging 0.55
R6269:Olfr1120 UTSW 2 87846874 missense possibly damaging 0.65
R6551:Olfr1120 UTSW 2 87846661 missense possibly damaging 0.89
R7024:Olfr1120 UTSW 2 87357722 missense probably benign 0.06
R7242:Olfr1120 UTSW 2 87358082 missense probably benign 0.13
R7359:Olfr1120 UTSW 2 87358211 missense possibly damaging 0.77
R7444:Olfr1120 UTSW 2 87358100 missense possibly damaging 0.94
R7488:Olfr1120 UTSW 2 87358253 missense probably damaging 1.00
R7646:Olfr1120 UTSW 2 87357758 missense probably benign 0.00
R7711:Olfr1120 UTSW 2 87357527 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GCACTATCCTCTGGTCATGAATCCAAC -3'
(R):5'- CCTACAGAATGAATGGACTTTGGCCTC -3'

Sequencing Primer
(F):5'- CTCTGGTCATGAATCCAACAAAGTG -3'
(R):5'- AATGGACTTTGGCCTCAAGTAG -3'
Posted On2014-02-18