Incidental Mutation 'R1298:Hao2'
ID158203
Institutional Source Beutler Lab
Gene Symbol Hao2
Ensembl Gene ENSMUSG00000027870
Gene Namehydroxyacid oxidase 2
SynonymsHao3
MMRRC Submission 039364-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1298 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location98874521-98893239 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 98883669 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 63 (T63K)
Ref Sequence ENSEMBL: ENSMUSP00000029464 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029464]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029464
AA Change: T63K

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000029464
Gene: ENSMUSG00000027870
AA Change: T63K

DomainStartEndE-ValueType
Pfam:FMN_dh 13 350 1.8e-127 PFAM
Pfam:Glu_synthase 258 314 1.1e-6 PFAM
Meta Mutation Damage Score 0.3113 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.1%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of three related genes that have 2-hydroxyacid oxidase activity. The encoded protein localizes to the peroxisome has the highest activity toward the substrate 2-hydroxypalmitate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Electrophoretic variants are known for this locus in kidney. The a allele determines a slow anodally migrating band in all inbred strains tested; the b allele determines a fast band in M. m. castaneus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox5 A G 6: 116,427,264 W145R probably damaging Het
Aspm T A 1: 139,457,419 V267D probably benign Het
Bbs4 A T 9: 59,339,813 W135R probably damaging Het
Cavin4 T C 4: 48,672,593 V346A probably benign Het
Cdk18 A C 1: 132,122,451 probably benign Het
Cyp2j11 C T 4: 96,307,260 probably null Het
Dnah6 A T 6: 73,159,135 I1007K probably damaging Het
Dnmt1 T C 9: 20,941,456 E118G probably benign Het
Eef2 C CN 10: 81,178,768 probably null Het
Gm14496 T C 2: 181,996,092 F320L probably benign Het
Gm2046 T A 12: 87,980,083 D98E probably benign Het
Gsdmc3 A T 15: 63,860,281 L299M probably damaging Het
H6pd T C 4: 149,982,514 I472V probably benign Het
Jag2 C T 12: 112,916,319 probably benign Het
Mapre3 A G 5: 30,864,867 Y211C probably damaging Het
Mycbp2 A G 14: 103,155,898 S2966P probably damaging Het
Nsd3 T A 8: 25,679,936 V696E possibly damaging Het
Obscn A G 11: 59,054,897 Y4163H possibly damaging Het
Olfr1120 G A 2: 87,358,070 A209T probably benign Het
Olfr747 A T 14: 50,680,880 Y251* probably null Het
Olfr788 G T 10: 129,473,064 C124F probably damaging Het
Pde2a A G 7: 101,507,202 E607G probably benign Het
Pinlyp T A 7: 24,544,966 D51V probably damaging Het
Rcbtb2 T A 14: 73,162,388 I87N probably damaging Het
Sfswap A G 5: 129,541,378 I459V probably benign Het
Slitrk6 T C 14: 110,751,865 N137D possibly damaging Het
Smg1 A T 7: 118,168,211 probably benign Het
Sobp T A 10: 43,022,335 H418L probably damaging Het
Spock1 A C 13: 57,512,750 D180E probably benign Het
Upk3a G A 15: 85,020,551 V167I probably benign Het
Vmn1r180 T C 7: 23,953,147 V245A possibly damaging Het
Zbtb25 T C 12: 76,350,001 E149G probably benign Het
Zgrf1 T C 3: 127,583,889 C44R possibly damaging Het
Other mutations in Hao2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01933:Hao2 APN 3 98880332 splice site probably benign
IGL03279:Hao2 APN 3 98880396 missense possibly damaging 0.88
goatherd UTSW 3 98877135 missense probably benign 0.06
R0600:Hao2 UTSW 3 98883560 splice site probably benign
R3176:Hao2 UTSW 3 98880328 splice site probably benign
R3177:Hao2 UTSW 3 98880328 splice site probably benign
R3786:Hao2 UTSW 3 98876752 missense probably damaging 1.00
R4486:Hao2 UTSW 3 98882025 missense probably damaging 1.00
R4487:Hao2 UTSW 3 98882025 missense probably damaging 1.00
R4488:Hao2 UTSW 3 98882025 missense probably damaging 1.00
R5290:Hao2 UTSW 3 98877177 missense probably damaging 0.99
R5760:Hao2 UTSW 3 98880432 nonsense probably null
R6129:Hao2 UTSW 3 98880526 missense probably benign 0.00
R6720:Hao2 UTSW 3 98877135 missense probably benign 0.06
R6861:Hao2 UTSW 3 98877182 missense probably damaging 1.00
R6991:Hao2 UTSW 3 98876752 missense probably damaging 1.00
R7203:Hao2 UTSW 3 98877282 splice site probably null
R8277:Hao2 UTSW 3 98880384 missense probably damaging 1.00
Z1088:Hao2 UTSW 3 98875352 missense probably damaging 1.00
Z1177:Hao2 UTSW 3 98881942 missense probably benign 0.02
Z1177:Hao2 UTSW 3 98882041 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGTAAGAGGTCCTGATGCTCCCTAC -3'
(R):5'- TGGGCAAAGATACCCTGGAAAGTTG -3'

Sequencing Primer
(F):5'- TACCACTTATCTGGGCGAGAAC -3'
(R):5'- GATACCCTGGAAAGTTGCCTACTC -3'
Posted On2014-02-18