Incidental Mutation 'R1298:Zgrf1'
ID158204
Institutional Source Beutler Lab
Gene Symbol Zgrf1
Ensembl Gene ENSMUSG00000051278
Gene Namezinc finger, GRF-type containing 1
Synonyms4930422G04Rik
MMRRC Submission 039364-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R1298 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location127553489-127618023 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 127583889 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 44 (C44R)
Ref Sequence ENSEMBL: ENSMUSP00000143570 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043108] [ENSMUST00000196141] [ENSMUST00000196341] [ENSMUST00000199888] [ENSMUST00000200490]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043108
AA Change: C928R

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000044432
Gene: ENSMUSG00000051278
AA Change: C928R

DomainStartEndE-ValueType
Pfam:DUF2439 3 81 3.7e-23 PFAM
low complexity region 92 105 N/A INTRINSIC
low complexity region 628 639 N/A INTRINSIC
low complexity region 896 906 N/A INTRINSIC
Pfam:zf-GRF 1109 1153 1.5e-17 PFAM
low complexity region 1316 1328 N/A INTRINSIC
Pfam:AAA_11 1501 1608 1.6e-21 PFAM
Pfam:AAA_12 1616 1802 1.3e-51 PFAM
coiled coil region 1833 1861 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000196141
AA Change: C928R

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143761
Gene: ENSMUSG00000051278
AA Change: C928R

DomainStartEndE-ValueType
Pfam:DUF2439 3 81 3.7e-23 PFAM
low complexity region 92 105 N/A INTRINSIC
low complexity region 628 639 N/A INTRINSIC
low complexity region 896 906 N/A INTRINSIC
Pfam:zf-GRF 1109 1153 1.5e-17 PFAM
low complexity region 1316 1328 N/A INTRINSIC
Pfam:AAA_11 1501 1608 1.6e-21 PFAM
Pfam:AAA_12 1616 1802 1.3e-51 PFAM
coiled coil region 1833 1861 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000196341
AA Change: C44R

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000143570
Gene: ENSMUSG00000051278
AA Change: C44R

DomainStartEndE-ValueType
low complexity region 12 22 N/A INTRINSIC
Pfam:zf-GRF 225 269 6.7e-15 PFAM
low complexity region 432 444 N/A INTRINSIC
Pfam:AAA_11 491 659 7.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199888
SMART Domains Protein: ENSMUSP00000142693
Gene: ENSMUSG00000051278

DomainStartEndE-ValueType
Pfam:DUF2439 3 82 3.5e-22 PFAM
low complexity region 92 105 N/A INTRINSIC
low complexity region 628 639 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200490
SMART Domains Protein: ENSMUSP00000143585
Gene: ENSMUSG00000051278

DomainStartEndE-ValueType
Pfam:DUF2439 3 81 3.4e-20 PFAM
low complexity region 92 105 N/A INTRINSIC
low complexity region 628 639 N/A INTRINSIC
Meta Mutation Damage Score 0.194 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.1%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox5 A G 6: 116,427,264 W145R probably damaging Het
Aspm T A 1: 139,457,419 V267D probably benign Het
Bbs4 A T 9: 59,339,813 W135R probably damaging Het
Cavin4 T C 4: 48,672,593 V346A probably benign Het
Cdk18 A C 1: 132,122,451 probably benign Het
Cyp2j11 C T 4: 96,307,260 probably null Het
Dnah6 A T 6: 73,159,135 I1007K probably damaging Het
Dnmt1 T C 9: 20,941,456 E118G probably benign Het
Eef2 C CN 10: 81,178,768 probably null Het
Gm14496 T C 2: 181,996,092 F320L probably benign Het
Gm2046 T A 12: 87,980,083 D98E probably benign Het
Gsdmc3 A T 15: 63,860,281 L299M probably damaging Het
H6pd T C 4: 149,982,514 I472V probably benign Het
Hao2 G T 3: 98,883,669 T63K possibly damaging Het
Jag2 C T 12: 112,916,319 probably benign Het
Mapre3 A G 5: 30,864,867 Y211C probably damaging Het
Mycbp2 A G 14: 103,155,898 S2966P probably damaging Het
Nsd3 T A 8: 25,679,936 V696E possibly damaging Het
Obscn A G 11: 59,054,897 Y4163H possibly damaging Het
Olfr1120 G A 2: 87,358,070 A209T probably benign Het
Olfr747 A T 14: 50,680,880 Y251* probably null Het
Olfr788 G T 10: 129,473,064 C124F probably damaging Het
Pde2a A G 7: 101,507,202 E607G probably benign Het
Pinlyp T A 7: 24,544,966 D51V probably damaging Het
Rcbtb2 T A 14: 73,162,388 I87N probably damaging Het
Sfswap A G 5: 129,541,378 I459V probably benign Het
Slitrk6 T C 14: 110,751,865 N137D possibly damaging Het
Smg1 A T 7: 118,168,211 probably benign Het
Sobp T A 10: 43,022,335 H418L probably damaging Het
Spock1 A C 13: 57,512,750 D180E probably benign Het
Upk3a G A 15: 85,020,551 V167I probably benign Het
Vmn1r180 T C 7: 23,953,147 V245A possibly damaging Het
Zbtb25 T C 12: 76,350,001 E149G probably benign Het
Other mutations in Zgrf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Zgrf1 APN 3 127588141 splice site probably benign
IGL01153:Zgrf1 APN 3 127602406 missense probably damaging 1.00
IGL01330:Zgrf1 APN 3 127584007 missense probably damaging 1.00
IGL01501:Zgrf1 APN 3 127602562 splice site probably null
IGL01827:Zgrf1 APN 3 127616281 missense probably benign 0.06
IGL02600:Zgrf1 APN 3 127600974 splice site probably benign
IGL03122:Zgrf1 APN 3 127588133 missense possibly damaging 0.91
IGL03365:Zgrf1 APN 3 127598774 missense possibly damaging 0.48
R0015:Zgrf1 UTSW 3 127555397 splice site probably benign
R0243:Zgrf1 UTSW 3 127615446 missense probably damaging 0.99
R0468:Zgrf1 UTSW 3 127562041 missense possibly damaging 0.72
R0497:Zgrf1 UTSW 3 127584650 splice site probably benign
R0505:Zgrf1 UTSW 3 127573238 missense probably benign 0.30
R0511:Zgrf1 UTSW 3 127584660 missense possibly damaging 0.93
R0539:Zgrf1 UTSW 3 127615192 missense probably damaging 1.00
R0617:Zgrf1 UTSW 3 127588038 missense probably benign 0.39
R1353:Zgrf1 UTSW 3 127611803 missense probably damaging 1.00
R1593:Zgrf1 UTSW 3 127561026 missense possibly damaging 0.86
R1846:Zgrf1 UTSW 3 127615463 missense probably damaging 1.00
R1912:Zgrf1 UTSW 3 127563137 missense probably benign
R2062:Zgrf1 UTSW 3 127613350 missense probably damaging 1.00
R2064:Zgrf1 UTSW 3 127613350 missense probably damaging 1.00
R2065:Zgrf1 UTSW 3 127613350 missense probably damaging 1.00
R2066:Zgrf1 UTSW 3 127613350 missense probably damaging 1.00
R2067:Zgrf1 UTSW 3 127613350 missense probably damaging 1.00
R2256:Zgrf1 UTSW 3 127561997 missense probably benign 0.18
R2321:Zgrf1 UTSW 3 127562407 nonsense probably null
R2381:Zgrf1 UTSW 3 127556214 missense probably benign 0.02
R2913:Zgrf1 UTSW 3 127598707 missense possibly damaging 0.65
R3147:Zgrf1 UTSW 3 127584148 missense possibly damaging 0.84
R3236:Zgrf1 UTSW 3 127613375 missense probably damaging 1.00
R3237:Zgrf1 UTSW 3 127613375 missense probably damaging 1.00
R4433:Zgrf1 UTSW 3 127562078 missense probably benign
R4441:Zgrf1 UTSW 3 127586137 missense possibly damaging 0.45
R4457:Zgrf1 UTSW 3 127595929 missense probably damaging 1.00
R4498:Zgrf1 UTSW 3 127586100 nonsense probably null
R4598:Zgrf1 UTSW 3 127601030 missense probably benign 0.14
R4701:Zgrf1 UTSW 3 127598704 missense probably benign 0.03
R4898:Zgrf1 UTSW 3 127602436 missense probably damaging 1.00
R4944:Zgrf1 UTSW 3 127561868 nonsense probably null
R5256:Zgrf1 UTSW 3 127602445 missense probably damaging 1.00
R5294:Zgrf1 UTSW 3 127600980 missense probably benign 0.14
R5358:Zgrf1 UTSW 3 127567703 critical splice donor site probably null
R5359:Zgrf1 UTSW 3 127601165 missense possibly damaging 0.95
R5447:Zgrf1 UTSW 3 127563119 missense possibly damaging 0.73
R5569:Zgrf1 UTSW 3 127561025 missense probably benign 0.33
R5887:Zgrf1 UTSW 3 127584765 missense probably damaging 1.00
R5914:Zgrf1 UTSW 3 127561023 missense probably damaging 0.99
R5925:Zgrf1 UTSW 3 127573204 missense possibly damaging 0.84
R5936:Zgrf1 UTSW 3 127562253 missense possibly damaging 0.72
R6087:Zgrf1 UTSW 3 127615486 missense probably damaging 1.00
R6089:Zgrf1 UTSW 3 127595993 missense probably damaging 1.00
R6181:Zgrf1 UTSW 3 127587941 missense probably damaging 1.00
R6277:Zgrf1 UTSW 3 127598812 missense possibly damaging 0.81
R6441:Zgrf1 UTSW 3 127588034 missense possibly damaging 0.93
R6659:Zgrf1 UTSW 3 127616506 missense probably damaging 0.99
R6857:Zgrf1 UTSW 3 127581447 missense probably damaging 0.99
R6932:Zgrf1 UTSW 3 127559632 critical splice donor site probably null
R7008:Zgrf1 UTSW 3 127561772 missense probably benign 0.18
R7175:Zgrf1 UTSW 3 127563590 missense probably damaging 1.00
R7264:Zgrf1 UTSW 3 127563569 missense probably benign 0.00
R7272:Zgrf1 UTSW 3 127598760 missense probably damaging 0.99
R7298:Zgrf1 UTSW 3 127583650 nonsense probably null
R7412:Zgrf1 UTSW 3 127563071 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AAAGTCGGAACTGTCCGCTCTTG -3'
(R):5'- GGAAACCAAATCCTGCTGCTGTTG -3'

Sequencing Primer
(F):5'- ACCATTGGTTTCCAGGACAG -3'
(R):5'- GATGGAGCAAGCCTTTTATCATCTG -3'
Posted On2014-02-18