Incidental Mutation 'R1298:Cavin4'
ID158205
Institutional Source Beutler Lab
Gene Symbol Cavin4
Ensembl Gene ENSMUSG00000028348
Gene Namecaveolae associated 4
Synonyms2310039E09Rik, cavin 4, Murc
MMRRC Submission 039364-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1298 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location48663514-48673502 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 48672593 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 346 (V346A)
Ref Sequence ENSEMBL: ENSMUSP00000030033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030033]
Predicted Effect probably benign
Transcript: ENSMUST00000030033
AA Change: V346A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000030033
Gene: ENSMUSG00000028348
AA Change: V346A

DomainStartEndE-ValueType
Pfam:PTRF_SDPR 27 263 7.8e-92 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117162
Meta Mutation Damage Score 0.0588 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.1%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing two coiled-coil regions. The encoded protein promotes Rho/ROCK (Rho-kinase) signaling in cardiac muscles cells, and may facilitate myofibrillar organization. [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygous null mice are viable and fertile with normal cardiac mass and function under physiological conditions. Phenylephrine-induced cardiac hypertrophy is suppressed in null mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox5 A G 6: 116,427,264 W145R probably damaging Het
Aspm T A 1: 139,457,419 V267D probably benign Het
Bbs4 A T 9: 59,339,813 W135R probably damaging Het
Cdk18 A C 1: 132,122,451 probably benign Het
Cyp2j11 C T 4: 96,307,260 probably null Het
Dnah6 A T 6: 73,159,135 I1007K probably damaging Het
Dnmt1 T C 9: 20,941,456 E118G probably benign Het
Eef2 C CN 10: 81,178,768 probably null Het
Gm14496 T C 2: 181,996,092 F320L probably benign Het
Gm2046 T A 12: 87,980,083 D98E probably benign Het
Gsdmc3 A T 15: 63,860,281 L299M probably damaging Het
H6pd T C 4: 149,982,514 I472V probably benign Het
Hao2 G T 3: 98,883,669 T63K possibly damaging Het
Jag2 C T 12: 112,916,319 probably benign Het
Mapre3 A G 5: 30,864,867 Y211C probably damaging Het
Mycbp2 A G 14: 103,155,898 S2966P probably damaging Het
Nsd3 T A 8: 25,679,936 V696E possibly damaging Het
Obscn A G 11: 59,054,897 Y4163H possibly damaging Het
Olfr1120 G A 2: 87,358,070 A209T probably benign Het
Olfr747 A T 14: 50,680,880 Y251* probably null Het
Olfr788 G T 10: 129,473,064 C124F probably damaging Het
Pde2a A G 7: 101,507,202 E607G probably benign Het
Pinlyp T A 7: 24,544,966 D51V probably damaging Het
Rcbtb2 T A 14: 73,162,388 I87N probably damaging Het
Sfswap A G 5: 129,541,378 I459V probably benign Het
Slitrk6 T C 14: 110,751,865 N137D possibly damaging Het
Smg1 A T 7: 118,168,211 probably benign Het
Sobp T A 10: 43,022,335 H418L probably damaging Het
Spock1 A C 13: 57,512,750 D180E probably benign Het
Upk3a G A 15: 85,020,551 V167I probably benign Het
Vmn1r180 T C 7: 23,953,147 V245A possibly damaging Het
Zbtb25 T C 12: 76,350,001 E149G probably benign Het
Zgrf1 T C 3: 127,583,889 C44R possibly damaging Het
Other mutations in Cavin4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1127:Cavin4 UTSW 4 48663637 missense probably damaging 1.00
R5389:Cavin4 UTSW 4 48663907 missense probably damaging 1.00
R5668:Cavin4 UTSW 4 48672499 missense probably benign
R5827:Cavin4 UTSW 4 48672074 missense probably damaging 1.00
R6145:Cavin4 UTSW 4 48663794 missense probably damaging 1.00
R6180:Cavin4 UTSW 4 48663917 missense possibly damaging 0.95
R6334:Cavin4 UTSW 4 48663824 missense possibly damaging 0.77
R6861:Cavin4 UTSW 4 48672214 missense probably benign 0.25
R7038:Cavin4 UTSW 4 48672479 missense probably benign 0.25
R7378:Cavin4 UTSW 4 48663631 missense probably benign 0.24
R7718:Cavin4 UTSW 4 48671984 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- ATTTCCAGTGCCGCTCCCTCAAAG -3'
(R):5'- AGCTGCCACGAAAAGGCATGAC -3'

Sequencing Primer
(F):5'- TTCGGAGCCTTAGGAAAGC -3'
(R):5'- GCTGTCAGAGTCATATATTCTCAGG -3'
Posted On2014-02-18