Incidental Mutation 'R1298:Mapre3'
ID158208
Institutional Source Beutler Lab
Gene Symbol Mapre3
Ensembl Gene ENSMUSG00000029166
Gene Namemicrotubule-associated protein, RP/EB family, member 3
SynonymsEB3
MMRRC Submission 039364-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.800) question?
Stock #R1298 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location30814641-30866106 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30864867 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 211 (Y211C)
Ref Sequence ENSEMBL: ENSMUSP00000143890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031058] [ENSMUST00000114716] [ENSMUST00000200692] [ENSMUST00000201203] [ENSMUST00000202501]
Predicted Effect probably damaging
Transcript: ENSMUST00000031058
AA Change: Y226C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031058
Gene: ENSMUSG00000029166
AA Change: Y226C

DomainStartEndE-ValueType
Pfam:CH 14 114 4.1e-10 PFAM
low complexity region 201 214 N/A INTRINSIC
Pfam:EB1 219 257 1.4e-17 PFAM
low complexity region 266 280 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114716
SMART Domains Protein: ENSMUSP00000110364
Gene: ENSMUSG00000038828

DomainStartEndE-ValueType
low complexity region 16 36 N/A INTRINSIC
low complexity region 84 94 N/A INTRINSIC
Pfam:DUF2359 172 638 8e-247 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000200692
AA Change: Y211C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143890
Gene: ENSMUSG00000029166
AA Change: Y211C

DomainStartEndE-ValueType
Pfam:CH 14 114 2.8e-12 PFAM
low complexity region 186 199 N/A INTRINSIC
Pfam:EB1 204 242 1.6e-21 PFAM
low complexity region 251 265 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201203
SMART Domains Protein: ENSMUSP00000144615
Gene: ENSMUSG00000038828

DomainStartEndE-ValueType
low complexity region 16 36 N/A INTRINSIC
low complexity region 84 94 N/A INTRINSIC
Pfam:DUF2359 217 683 6.9e-246 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201347
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202025
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202050
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202256
Predicted Effect probably benign
Transcript: ENSMUST00000202501
SMART Domains Protein: ENSMUSP00000144591
Gene: ENSMUSG00000029166

DomainStartEndE-ValueType
Pfam:CH 14 114 6.9e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202534
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202951
Meta Mutation Damage Score 0.7638 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.1%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the RP/EB family of genes. The protein localizes to the cytoplasmic microtubule network and binds APCL, a homolog of the adenomatous polyposis coli tumor suppressor gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele activated in endothelial cells fail to exhibit F2r agonist-induced vascular hyper-permeability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox5 A G 6: 116,427,264 W145R probably damaging Het
Aspm T A 1: 139,457,419 V267D probably benign Het
Bbs4 A T 9: 59,339,813 W135R probably damaging Het
Cavin4 T C 4: 48,672,593 V346A probably benign Het
Cdk18 A C 1: 132,122,451 probably benign Het
Cyp2j11 C T 4: 96,307,260 probably null Het
Dnah6 A T 6: 73,159,135 I1007K probably damaging Het
Dnmt1 T C 9: 20,941,456 E118G probably benign Het
Eef2 C CN 10: 81,178,768 probably null Het
Gm14496 T C 2: 181,996,092 F320L probably benign Het
Gm2046 T A 12: 87,980,083 D98E probably benign Het
Gsdmc3 A T 15: 63,860,281 L299M probably damaging Het
H6pd T C 4: 149,982,514 I472V probably benign Het
Hao2 G T 3: 98,883,669 T63K possibly damaging Het
Jag2 C T 12: 112,916,319 probably benign Het
Mycbp2 A G 14: 103,155,898 S2966P probably damaging Het
Nsd3 T A 8: 25,679,936 V696E possibly damaging Het
Obscn A G 11: 59,054,897 Y4163H possibly damaging Het
Olfr1120 G A 2: 87,358,070 A209T probably benign Het
Olfr747 A T 14: 50,680,880 Y251* probably null Het
Olfr788 G T 10: 129,473,064 C124F probably damaging Het
Pde2a A G 7: 101,507,202 E607G probably benign Het
Pinlyp T A 7: 24,544,966 D51V probably damaging Het
Rcbtb2 T A 14: 73,162,388 I87N probably damaging Het
Sfswap A G 5: 129,541,378 I459V probably benign Het
Slitrk6 T C 14: 110,751,865 N137D possibly damaging Het
Smg1 A T 7: 118,168,211 probably benign Het
Sobp T A 10: 43,022,335 H418L probably damaging Het
Spock1 A C 13: 57,512,750 D180E probably benign Het
Upk3a G A 15: 85,020,551 V167I probably benign Het
Vmn1r180 T C 7: 23,953,147 V245A possibly damaging Het
Zbtb25 T C 12: 76,350,001 E149G probably benign Het
Zgrf1 T C 3: 127,583,889 C44R possibly damaging Het
Other mutations in Mapre3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01062:Mapre3 APN 5 30864896 missense probably benign 0.15
IGL01391:Mapre3 APN 5 30864897 missense probably damaging 1.00
IGL02650:Mapre3 APN 5 30864709 missense probably damaging 0.97
capen UTSW 5 30864867 missense probably damaging 1.00
R1272:Mapre3 UTSW 5 30861888 missense probably damaging 1.00
R1447:Mapre3 UTSW 5 30861807 splice site probably benign
R1524:Mapre3 UTSW 5 30861917 missense probably damaging 0.99
R2006:Mapre3 UTSW 5 30861824 missense probably damaging 1.00
R2086:Mapre3 UTSW 5 30863202 critical splice acceptor site probably null
R5864:Mapre3 UTSW 5 30863238 missense probably damaging 1.00
R6630:Mapre3 UTSW 5 30862542 missense probably damaging 0.98
R7348:Mapre3 UTSW 5 30861829 missense probably benign 0.05
R8143:Mapre3 UTSW 5 30863375 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- AGAACATGCAGACCTCTGGACGAC -3'
(R):5'- GGAAGGATCAGGTTCACACTCAGC -3'

Sequencing Primer
(F):5'- TCTGGACGACTCAGCAACG -3'
(R):5'- GGTTCACACTCAGCCTAGAAAC -3'
Posted On2014-02-18