Incidental Mutation 'R1298:Sfswap'
ID 158209
Institutional Source Beutler Lab
Gene Symbol Sfswap
Ensembl Gene ENSMUSG00000029439
Gene Name splicing factor SWAP
Synonyms Sfrs8, 6330437E22Rik, 1190005N23Rik
MMRRC Submission 039364-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1298 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 129501221-129571384 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 129541378 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 459 (I459V)
Ref Sequence ENSEMBL: ENSMUSP00000062413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053737] [ENSMUST00000196698]
AlphaFold Q3USH5
Predicted Effect probably benign
Transcript: ENSMUST00000053737
AA Change: I459V

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000062413
Gene: ENSMUSG00000029439
AA Change: I459V

DomainStartEndE-ValueType
low complexity region 22 30 N/A INTRINSIC
DRY_EERY 33 157 1.15e-57 SMART
low complexity region 160 170 N/A INTRINSIC
low complexity region 174 186 N/A INTRINSIC
SWAP 209 262 3.94e-19 SMART
low complexity region 286 293 N/A INTRINSIC
low complexity region 333 352 N/A INTRINSIC
low complexity region 397 441 N/A INTRINSIC
SWAP 456 507 9.55e-18 SMART
low complexity region 513 532 N/A INTRINSIC
low complexity region 548 562 N/A INTRINSIC
low complexity region 598 607 N/A INTRINSIC
coiled coil region 631 686 N/A INTRINSIC
low complexity region 741 788 N/A INTRINSIC
low complexity region 797 821 N/A INTRINSIC
low complexity region 840 865 N/A INTRINSIC
low complexity region 871 888 N/A INTRINSIC
low complexity region 889 905 N/A INTRINSIC
low complexity region 909 920 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196698
SMART Domains Protein: ENSMUSP00000142464
Gene: ENSMUSG00000029439

DomainStartEndE-ValueType
low complexity region 22 30 N/A INTRINSIC
DRY_EERY 33 121 1.8e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199215
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199925
Meta Mutation Damage Score 0.3428 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.1%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a human homolog of Drosophila splicing regulatory protein. This gene autoregulates its expression by control of splicing of its first two introns. In addition, it also regulates the splicing of fibronectin and CD45 genes. Two transcript variants encoding different isoforms have been identified. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit a wobbly phenotype with inner ear defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox5 A G 6: 116,427,264 (GRCm38) W145R probably damaging Het
Aspm T A 1: 139,457,419 (GRCm38) V267D probably benign Het
Bbs4 A T 9: 59,339,813 (GRCm38) W135R probably damaging Het
Cavin4 T C 4: 48,672,593 (GRCm38) V346A probably benign Het
Cdk18 A C 1: 132,122,451 (GRCm38) probably benign Het
Cyp2j11 C T 4: 96,307,260 (GRCm38) probably null Het
Dnah6 A T 6: 73,159,135 (GRCm38) I1007K probably damaging Het
Dnmt1 T C 9: 20,941,456 (GRCm38) E118G probably benign Het
Eef2 C CN 10: 81,178,768 (GRCm38) probably null Het
Eif1ad5 T A 12: 87,980,083 (GRCm38) D98E probably benign Het
Gm14496 T C 2: 181,996,092 (GRCm38) F320L probably benign Het
Gsdmc3 A T 15: 63,860,281 (GRCm38) L299M probably damaging Het
H6pd T C 4: 149,982,514 (GRCm38) I472V probably benign Het
Hao2 G T 3: 98,883,669 (GRCm38) T63K possibly damaging Het
Jag2 C T 12: 112,916,319 (GRCm38) probably benign Het
Mapre3 A G 5: 30,864,867 (GRCm38) Y211C probably damaging Het
Mycbp2 A G 14: 103,155,898 (GRCm38) S2966P probably damaging Het
Nsd3 T A 8: 25,679,936 (GRCm38) V696E possibly damaging Het
Obscn A G 11: 59,054,897 (GRCm38) Y4163H possibly damaging Het
Or11h4b A T 14: 50,680,880 (GRCm38) Y251* probably null Het
Or12e8 G A 2: 87,358,070 (GRCm38) A209T probably benign Het
Or6c3 G T 10: 129,473,064 (GRCm38) C124F probably damaging Het
Pde2a A G 7: 101,507,202 (GRCm38) E607G probably benign Het
Pinlyp T A 7: 24,544,966 (GRCm38) D51V probably damaging Het
Rcbtb2 T A 14: 73,162,388 (GRCm38) I87N probably damaging Het
Slitrk6 T C 14: 110,751,865 (GRCm38) N137D possibly damaging Het
Smg1 A T 7: 118,168,211 (GRCm38) probably benign Het
Sobp T A 10: 43,022,335 (GRCm38) H418L probably damaging Het
Spock1 A C 13: 57,512,750 (GRCm38) D180E probably benign Het
Upk3a G A 15: 85,020,551 (GRCm38) V167I probably benign Het
Vmn1r180 T C 7: 23,953,147 (GRCm38) V245A possibly damaging Het
Zbtb25 T C 12: 76,350,001 (GRCm38) E149G probably benign Het
Zgrf1 T C 3: 127,583,889 (GRCm38) C44R possibly damaging Het
Other mutations in Sfswap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00740:Sfswap APN 5 129,513,233 (GRCm38) missense probably damaging 1.00
IGL02064:Sfswap APN 5 129,560,796 (GRCm38) missense probably benign 0.17
IGL02083:Sfswap APN 5 129,539,791 (GRCm38) missense probably benign
IGL02378:Sfswap APN 5 129,539,604 (GRCm38) missense probably damaging 1.00
FR4340:Sfswap UTSW 5 129,569,751 (GRCm38) unclassified probably benign
FR4342:Sfswap UTSW 5 129,569,757 (GRCm38) unclassified probably benign
FR4449:Sfswap UTSW 5 129,569,749 (GRCm38) unclassified probably benign
FR4449:Sfswap UTSW 5 129,569,748 (GRCm38) unclassified probably benign
FR4548:Sfswap UTSW 5 129,569,755 (GRCm38) unclassified probably benign
FR4548:Sfswap UTSW 5 129,569,749 (GRCm38) unclassified probably benign
FR4737:Sfswap UTSW 5 129,569,756 (GRCm38) unclassified probably benign
FR4976:Sfswap UTSW 5 129,569,751 (GRCm38) unclassified probably benign
I1329:Sfswap UTSW 5 129,507,137 (GRCm38) unclassified probably benign
P0033:Sfswap UTSW 5 129,539,755 (GRCm38) missense possibly damaging 0.60
R0184:Sfswap UTSW 5 129,507,189 (GRCm38) missense probably damaging 0.97
R0233:Sfswap UTSW 5 129,554,543 (GRCm38) missense possibly damaging 0.82
R0233:Sfswap UTSW 5 129,554,543 (GRCm38) missense possibly damaging 0.82
R0414:Sfswap UTSW 5 129,504,051 (GRCm38) missense possibly damaging 0.83
R0415:Sfswap UTSW 5 129,504,126 (GRCm38) missense probably damaging 1.00
R0570:Sfswap UTSW 5 129,503,978 (GRCm38) splice site probably benign
R1018:Sfswap UTSW 5 129,554,576 (GRCm38) missense possibly damaging 0.91
R1173:Sfswap UTSW 5 129,507,143 (GRCm38) critical splice acceptor site probably null
R1723:Sfswap UTSW 5 129,539,694 (GRCm38) missense probably benign
R1783:Sfswap UTSW 5 129,513,240 (GRCm38) missense possibly damaging 0.92
R1828:Sfswap UTSW 5 129,513,084 (GRCm38) missense probably damaging 1.00
R1879:Sfswap UTSW 5 129,541,328 (GRCm38) missense probably benign 0.01
R2078:Sfswap UTSW 5 129,516,107 (GRCm38) missense possibly damaging 0.81
R2349:Sfswap UTSW 5 129,569,738 (GRCm38) missense possibly damaging 0.87
R3757:Sfswap UTSW 5 129,513,234 (GRCm38) missense probably damaging 1.00
R4093:Sfswap UTSW 5 129,560,741 (GRCm38) missense possibly damaging 0.85
R4094:Sfswap UTSW 5 129,560,741 (GRCm38) missense possibly damaging 0.85
R4095:Sfswap UTSW 5 129,560,741 (GRCm38) missense possibly damaging 0.85
R4785:Sfswap UTSW 5 129,513,083 (GRCm38) missense probably damaging 1.00
R5139:Sfswap UTSW 5 129,571,009 (GRCm38) missense possibly damaging 0.73
R5355:Sfswap UTSW 5 129,539,746 (GRCm38) missense probably benign 0.09
R5481:Sfswap UTSW 5 129,514,818 (GRCm38) missense probably damaging 0.98
R5600:Sfswap UTSW 5 129,513,158 (GRCm38) missense probably damaging 1.00
R5686:Sfswap UTSW 5 129,514,818 (GRCm38) missense probably damaging 0.98
R5906:Sfswap UTSW 5 129,542,043 (GRCm38) missense probably benign 0.22
R6332:Sfswap UTSW 5 129,571,041 (GRCm38) missense possibly damaging 0.91
R6738:Sfswap UTSW 5 129,541,441 (GRCm38) missense probably damaging 0.98
R6743:Sfswap UTSW 5 129,550,819 (GRCm38) nonsense probably null
R7371:Sfswap UTSW 5 129,543,241 (GRCm38) missense probably benign 0.01
R7747:Sfswap UTSW 5 129,550,593 (GRCm38) splice site probably null
R8286:Sfswap UTSW 5 129,539,719 (GRCm38) missense probably damaging 0.99
R8738:Sfswap UTSW 5 129,543,281 (GRCm38) missense possibly damaging 0.52
R8943:Sfswap UTSW 5 129,504,104 (GRCm38) missense probably damaging 1.00
R9119:Sfswap UTSW 5 129,514,765 (GRCm38) missense probably benign
R9587:Sfswap UTSW 5 129,541,363 (GRCm38) missense probably benign 0.00
R9601:Sfswap UTSW 5 129,541,399 (GRCm38) missense possibly damaging 0.94
R9718:Sfswap UTSW 5 129,539,784 (GRCm38) missense probably benign
RF003:Sfswap UTSW 5 129,569,764 (GRCm38) unclassified probably benign
RF042:Sfswap UTSW 5 129,569,743 (GRCm38) unclassified probably benign
RF049:Sfswap UTSW 5 129,569,744 (GRCm38) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GCAATCTCACTCCCAGCAGTGATAC -3'
(R):5'- AACATGGGGCTTGATCCCAGAAAC -3'

Sequencing Primer
(F):5'- CAGCAGTGATACTCTGGGTC -3'
(R):5'- GGCTTGATCCCAGAAACTCATAAATG -3'
Posted On 2014-02-18