Incidental Mutation 'R1298:Alox5'
ID 158211
Institutional Source Beutler Lab
Gene Symbol Alox5
Ensembl Gene ENSMUSG00000025701
Gene Name arachidonate 5-lipoxygenase
Synonyms 5LO, 5-LOX, 5LX
MMRRC Submission 039364-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.124) question?
Stock # R1298 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 116410077-116461178 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 116427264 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 145 (W145R)
Ref Sequence ENSEMBL: ENSMUSP00000145367 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026795] [ENSMUST00000164547] [ENSMUST00000170186] [ENSMUST00000203722]
AlphaFold P48999
Predicted Effect probably damaging
Transcript: ENSMUST00000026795
AA Change: W145R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026795
Gene: ENSMUSG00000025701
AA Change: W145R

DomainStartEndE-ValueType
LH2 2 115 3.41e-39 SMART
Pfam:Lipoxygenase 212 662 1.5e-79 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164547
AA Change: W145R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130780
Gene: ENSMUSG00000025701
AA Change: W145R

DomainStartEndE-ValueType
LH2 2 115 3.41e-39 SMART
Pfam:Lipoxygenase 125 217 5.1e-12 PFAM
Pfam:Lipoxygenase 213 564 8.4e-133 PFAM
Pfam:Lipoxygenase 558 609 7.3e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167174
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167447
Predicted Effect probably damaging
Transcript: ENSMUST00000170186
AA Change: W145R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130424
Gene: ENSMUSG00000025701
AA Change: W145R

DomainStartEndE-ValueType
LH2 2 115 3.41e-39 SMART
Pfam:Lipoxygenase 150 220 1.9e-13 PFAM
Pfam:Lipoxygenase 215 432 8.6e-79 PFAM
Pfam:Lipoxygenase 426 634 1e-73 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203722
AA Change: W145R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145367
Gene: ENSMUSG00000025701
AA Change: W145R

DomainStartEndE-ValueType
LH2 2 115 2.2e-41 SMART
Pfam:Lipoxygenase 213 430 3e-35 PFAM
Meta Mutation Damage Score 0.9748 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.1%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the lipoxygenase gene family and plays a dual role in the synthesis of leukotrienes from arachidonic acid. The encoded protein, which is expressed specifically in bone marrow-derived cells, catalyzes the conversion of arachidonic acid to 5(S)-hydroperoxy-6-trans-8,11,14-cis-eicosatetraenoic acid, and further to the allylic epoxide 5(S)-trans-7,9-trans-11,14-cis-eicosatetrenoic acid (leukotriene A4). Leukotrienes are important mediators of a number of inflammatory and allergic conditions. Mutations in the promoter region of this gene lead to a diminished response to antileukotriene drugs used in the treatment of asthma and may also be associated with atherosclerosis and several cancers. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Nullizygous mice show altered inflammatory responses. One null mutation causes resistance to lethal anaphylaxis, abnormal eicosanoid production and neutrophil recruitment while another leads to increased body fat, bone density, leptin and VLDL cholesterol levels and resistance to autoimmune uveitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aspm T A 1: 139,457,419 V267D probably benign Het
Bbs4 A T 9: 59,339,813 W135R probably damaging Het
Cavin4 T C 4: 48,672,593 V346A probably benign Het
Cdk18 A C 1: 132,122,451 probably benign Het
Cyp2j11 C T 4: 96,307,260 probably null Het
Dnah6 A T 6: 73,159,135 I1007K probably damaging Het
Dnmt1 T C 9: 20,941,456 E118G probably benign Het
Eef2 C CN 10: 81,178,768 probably null Het
Gm14496 T C 2: 181,996,092 F320L probably benign Het
Gm2046 T A 12: 87,980,083 D98E probably benign Het
Gsdmc3 A T 15: 63,860,281 L299M probably damaging Het
H6pd T C 4: 149,982,514 I472V probably benign Het
Hao2 G T 3: 98,883,669 T63K possibly damaging Het
Jag2 C T 12: 112,916,319 probably benign Het
Mapre3 A G 5: 30,864,867 Y211C probably damaging Het
Mycbp2 A G 14: 103,155,898 S2966P probably damaging Het
Nsd3 T A 8: 25,679,936 V696E possibly damaging Het
Obscn A G 11: 59,054,897 Y4163H possibly damaging Het
Olfr1120 G A 2: 87,358,070 A209T probably benign Het
Olfr747 A T 14: 50,680,880 Y251* probably null Het
Olfr788 G T 10: 129,473,064 C124F probably damaging Het
Pde2a A G 7: 101,507,202 E607G probably benign Het
Pinlyp T A 7: 24,544,966 D51V probably damaging Het
Rcbtb2 T A 14: 73,162,388 I87N probably damaging Het
Sfswap A G 5: 129,541,378 I459V probably benign Het
Slitrk6 T C 14: 110,751,865 N137D possibly damaging Het
Smg1 A T 7: 118,168,211 probably benign Het
Sobp T A 10: 43,022,335 H418L probably damaging Het
Spock1 A C 13: 57,512,750 D180E probably benign Het
Upk3a G A 15: 85,020,551 V167I probably benign Het
Vmn1r180 T C 7: 23,953,147 V245A possibly damaging Het
Zbtb25 T C 12: 76,350,001 E149G probably benign Het
Zgrf1 T C 3: 127,583,889 C44R possibly damaging Het
Other mutations in Alox5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Alox5 APN 6 116415517 missense probably damaging 1.00
IGL00954:Alox5 APN 6 116454299 missense probably damaging 1.00
IGL01610:Alox5 APN 6 116413547 missense probably damaging 1.00
IGL02161:Alox5 APN 6 116423193 missense probably benign 0.31
IGL02653:Alox5 APN 6 116415477 missense probably benign 0.41
IGL02903:Alox5 APN 6 116420335 missense probably damaging 1.00
clanger UTSW 6 116414595 missense probably damaging 1.00
nova UTSW 6 116412549 nonsense probably null
timpani UTSW 6 116415456 missense probably damaging 1.00
Triangle UTSW 6 116427137 splice site probably null
R0265:Alox5 UTSW 6 116420362 missense probably benign 0.04
R0347:Alox5 UTSW 6 116413552 missense possibly damaging 0.88
R0543:Alox5 UTSW 6 116454317 critical splice acceptor site probably null
R0633:Alox5 UTSW 6 116420384 missense probably damaging 1.00
R0656:Alox5 UTSW 6 116423330 splice site probably benign
R1416:Alox5 UTSW 6 116423145 nonsense probably null
R1484:Alox5 UTSW 6 116454167 missense probably damaging 1.00
R1485:Alox5 UTSW 6 116424164 missense probably damaging 1.00
R1518:Alox5 UTSW 6 116413780 missense probably damaging 0.99
R1993:Alox5 UTSW 6 116415463 missense probably damaging 1.00
R2313:Alox5 UTSW 6 116413861 missense probably benign 0.00
R3125:Alox5 UTSW 6 116427137 splice site probably null
R4042:Alox5 UTSW 6 116461018 missense possibly damaging 0.95
R4092:Alox5 UTSW 6 116412674 intron probably benign
R4356:Alox5 UTSW 6 116420258 missense probably benign 0.05
R4367:Alox5 UTSW 6 116460963 missense possibly damaging 0.86
R4690:Alox5 UTSW 6 116423189 missense probably damaging 1.00
R4792:Alox5 UTSW 6 116461003 missense possibly damaging 0.94
R4873:Alox5 UTSW 6 116413850 splice site probably null
R4875:Alox5 UTSW 6 116413850 splice site probably null
R5135:Alox5 UTSW 6 116413786 missense probably benign 0.00
R5242:Alox5 UTSW 6 116460966 missense probably damaging 0.97
R5343:Alox5 UTSW 6 116413507 missense possibly damaging 0.95
R5780:Alox5 UTSW 6 116420349 missense probably benign 0.10
R6348:Alox5 UTSW 6 116414595 missense probably damaging 1.00
R6724:Alox5 UTSW 6 116414548 missense probably damaging 1.00
R6769:Alox5 UTSW 6 116415184 splice site probably null
R6954:Alox5 UTSW 6 116420280 nonsense probably null
R7102:Alox5 UTSW 6 116413468 missense probably benign 0.01
R7476:Alox5 UTSW 6 116415433 missense probably benign 0.06
R7626:Alox5 UTSW 6 116413795 missense possibly damaging 0.94
R7690:Alox5 UTSW 6 116415456 missense probably damaging 1.00
R7912:Alox5 UTSW 6 116412536 missense probably benign 0.05
R8234:Alox5 UTSW 6 116413874 missense probably damaging 0.98
R8701:Alox5 UTSW 6 116413826 missense possibly damaging 0.47
R8787:Alox5 UTSW 6 116413141 missense probably damaging 0.99
R8910:Alox5 UTSW 6 116412549 nonsense probably null
R9708:Alox5 UTSW 6 116415576 missense probably damaging 1.00
X0028:Alox5 UTSW 6 116424154 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCCCTTCTGATCAAGAGTACAGC -3'
(R):5'- TGGAAAGATTCCTGGCACTTCCAC -3'

Sequencing Primer
(F):5'- GATCAAGAGTACAGCTTTCCTGG -3'
(R):5'- TCAGCTCAGGGGATAGCCAAA -3'
Posted On 2014-02-18