Incidental Mutation 'R1298:Pinlyp'
ID158213
Institutional Source Beutler Lab
Gene Symbol Pinlyp
Ensembl Gene ENSMUSG00000011632
Gene Namephospholipase A2 inhibitor and LY6/PLAUR domain containing
Synonyms2310033E01Rik
MMRRC Submission 039364-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R1298 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location24541658-24546118 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24544966 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 51 (D51V)
Ref Sequence ENSEMBL: ENSMUSP00000011776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011776] [ENSMUST00000063249] [ENSMUST00000205573]
Predicted Effect probably damaging
Transcript: ENSMUST00000011776
AA Change: D51V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000011776
Gene: ENSMUSG00000011632
AA Change: D51V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LU 27 123 9.63e-2 SMART
Pfam:UPAR_LY6 126 191 1.3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000063249
SMART Domains Protein: ENSMUSP00000070995
Gene: ENSMUSG00000051768

DomainStartEndE-ValueType
Pfam:XRCC1_N 1 151 6.9e-66 PFAM
low complexity region 212 238 N/A INTRINSIC
low complexity region 278 294 N/A INTRINSIC
BRCT 317 393 8e-19 SMART
low complexity region 407 424 N/A INTRINSIC
low complexity region 444 459 N/A INTRINSIC
BRCT 538 617 5.5e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205561
Predicted Effect probably benign
Transcript: ENSMUST00000205573
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206067
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206620
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206889
Meta Mutation Damage Score 0.1279 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.1%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox5 A G 6: 116,427,264 W145R probably damaging Het
Aspm T A 1: 139,457,419 V267D probably benign Het
Bbs4 A T 9: 59,339,813 W135R probably damaging Het
Cavin4 T C 4: 48,672,593 V346A probably benign Het
Cdk18 A C 1: 132,122,451 probably benign Het
Cyp2j11 C T 4: 96,307,260 probably null Het
Dnah6 A T 6: 73,159,135 I1007K probably damaging Het
Dnmt1 T C 9: 20,941,456 E118G probably benign Het
Eef2 C CN 10: 81,178,768 probably null Het
Gm14496 T C 2: 181,996,092 F320L probably benign Het
Gm2046 T A 12: 87,980,083 D98E probably benign Het
Gsdmc3 A T 15: 63,860,281 L299M probably damaging Het
H6pd T C 4: 149,982,514 I472V probably benign Het
Hao2 G T 3: 98,883,669 T63K possibly damaging Het
Jag2 C T 12: 112,916,319 probably benign Het
Mapre3 A G 5: 30,864,867 Y211C probably damaging Het
Mycbp2 A G 14: 103,155,898 S2966P probably damaging Het
Nsd3 T A 8: 25,679,936 V696E possibly damaging Het
Obscn A G 11: 59,054,897 Y4163H possibly damaging Het
Olfr1120 G A 2: 87,358,070 A209T probably benign Het
Olfr747 A T 14: 50,680,880 Y251* probably null Het
Olfr788 G T 10: 129,473,064 C124F probably damaging Het
Pde2a A G 7: 101,507,202 E607G probably benign Het
Rcbtb2 T A 14: 73,162,388 I87N probably damaging Het
Sfswap A G 5: 129,541,378 I459V probably benign Het
Slitrk6 T C 14: 110,751,865 N137D possibly damaging Het
Smg1 A T 7: 118,168,211 probably benign Het
Sobp T A 10: 43,022,335 H418L probably damaging Het
Spock1 A C 13: 57,512,750 D180E probably benign Het
Upk3a G A 15: 85,020,551 V167I probably benign Het
Vmn1r180 T C 7: 23,953,147 V245A possibly damaging Het
Zbtb25 T C 12: 76,350,001 E149G probably benign Het
Zgrf1 T C 3: 127,583,889 C44R possibly damaging Het
Other mutations in Pinlyp
AlleleSourceChrCoordTypePredicted EffectPPH Score
BB001:Pinlyp UTSW 7 24542125 missense possibly damaging 0.79
BB011:Pinlyp UTSW 7 24542125 missense possibly damaging 0.79
R0454:Pinlyp UTSW 7 24542522 missense possibly damaging 0.77
R2163:Pinlyp UTSW 7 24541801 missense probably benign 0.41
R2219:Pinlyp UTSW 7 24546008 unclassified probably benign
R3779:Pinlyp UTSW 7 24541835 missense probably benign 0.20
R4777:Pinlyp UTSW 7 24542143 missense possibly damaging 0.57
R5432:Pinlyp UTSW 7 24542467 missense probably damaging 1.00
R6101:Pinlyp UTSW 7 24545980 missense possibly damaging 0.70
R7855:Pinlyp UTSW 7 24542440 critical splice donor site probably null
R7924:Pinlyp UTSW 7 24542125 missense possibly damaging 0.79
R7949:Pinlyp UTSW 7 24545950 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGTGTCCTCTCATAGTTACCTCACCAAG -3'
(R):5'- AAAGCCCAAGTCACGGTCTGAAG -3'

Sequencing Primer
(F):5'- agaccattgtgagccacc -3'
(R):5'- ACGGTCTGAAGACCTTCTTTAAC -3'
Posted On2014-02-18