Incidental Mutation 'R1298:Bbs4'
ID158218
Institutional Source Beutler Lab
Gene Symbol Bbs4
Ensembl Gene ENSMUSG00000025235
Gene NameBardet-Biedl syndrome 4 (human)
SynonymsD9Ertd464e
MMRRC Submission 039364-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.441) question?
Stock #R1298 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location59321990-59353508 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 59339813 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 135 (W135R)
Ref Sequence ENSEMBL: ENSMUSP00000026265 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026265]
Predicted Effect probably damaging
Transcript: ENSMUST00000026265
AA Change: W135R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026265
Gene: ENSMUSG00000025235
AA Change: W135R

DomainStartEndE-ValueType
TPR 67 100 1.64e1 SMART
TPR 101 134 1.14e1 SMART
TPR 135 168 5.19e-3 SMART
TPR 169 201 3.67e-3 SMART
TPR 202 235 9.68e-3 SMART
TPR 270 303 1.26e-1 SMART
TPR 304 337 2.38e-2 SMART
TPR 338 371 1.64e1 SMART
low complexity region 490 504 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214225
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214832
Meta Mutation Damage Score 0.9231 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.1%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Bardet-Biedl syndrome (BBS) gene family. Bardet-Biedl syndrome is an autosomal recessive disorder characterized by severe pigmentary retinopathy, obesity, polydactyly, renal malformation and mental retardation. The proteins encoded by BBS gene family members are structurally diverse. The similar phenotypes exhibited by mutations in BBS gene family members are likely due to the protein's shared roles in cilia formation and function. Many BBS proteins localize to the basal bodies, ciliary axonemes, and pericentriolar regions of cells. BBS proteins may also be involved in intracellular trafficking via microtubule-related transport. The protein encoded by this gene has sequence similarity to O-linked N-acetylglucosamine (O-GlcNAc) transferases in plants and archaebacteria and in human forms a multi-protein "BBSome" complex with seven other BBS proteins. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Homozygous null mice display partial embryonic lethality, low body weight before weaning, obesity and polyphagia after weaning, retinal degeneration, male infertility, absence of sperm cell flagella, renal abnormalities, impaired olfaction, and abnormal olfactory epithelium and neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox5 A G 6: 116,427,264 W145R probably damaging Het
Aspm T A 1: 139,457,419 V267D probably benign Het
Cavin4 T C 4: 48,672,593 V346A probably benign Het
Cdk18 A C 1: 132,122,451 probably benign Het
Cyp2j11 C T 4: 96,307,260 probably null Het
Dnah6 A T 6: 73,159,135 I1007K probably damaging Het
Dnmt1 T C 9: 20,941,456 E118G probably benign Het
Eef2 C CN 10: 81,178,768 probably null Het
Gm14496 T C 2: 181,996,092 F320L probably benign Het
Gm2046 T A 12: 87,980,083 D98E probably benign Het
Gsdmc3 A T 15: 63,860,281 L299M probably damaging Het
H6pd T C 4: 149,982,514 I472V probably benign Het
Hao2 G T 3: 98,883,669 T63K possibly damaging Het
Jag2 C T 12: 112,916,319 probably benign Het
Mapre3 A G 5: 30,864,867 Y211C probably damaging Het
Mycbp2 A G 14: 103,155,898 S2966P probably damaging Het
Nsd3 T A 8: 25,679,936 V696E possibly damaging Het
Obscn A G 11: 59,054,897 Y4163H possibly damaging Het
Olfr1120 G A 2: 87,358,070 A209T probably benign Het
Olfr747 A T 14: 50,680,880 Y251* probably null Het
Olfr788 G T 10: 129,473,064 C124F probably damaging Het
Pde2a A G 7: 101,507,202 E607G probably benign Het
Pinlyp T A 7: 24,544,966 D51V probably damaging Het
Rcbtb2 T A 14: 73,162,388 I87N probably damaging Het
Sfswap A G 5: 129,541,378 I459V probably benign Het
Slitrk6 T C 14: 110,751,865 N137D possibly damaging Het
Smg1 A T 7: 118,168,211 probably benign Het
Sobp T A 10: 43,022,335 H418L probably damaging Het
Spock1 A C 13: 57,512,750 D180E probably benign Het
Upk3a G A 15: 85,020,551 V167I probably benign Het
Vmn1r180 T C 7: 23,953,147 V245A possibly damaging Het
Zbtb25 T C 12: 76,350,001 E149G probably benign Het
Zgrf1 T C 3: 127,583,889 C44R possibly damaging Het
Other mutations in Bbs4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Bbs4 APN 9 59324065 missense probably benign 0.00
IGL01360:Bbs4 APN 9 59339848 missense possibly damaging 0.89
IGL02005:Bbs4 APN 9 59336355 splice site probably benign
IGL02150:Bbs4 APN 9 59336368 missense probably benign
IGL02278:Bbs4 APN 9 59341168 missense possibly damaging 0.64
IGL02402:Bbs4 APN 9 59330446 missense probably benign 0.41
IGL02593:Bbs4 APN 9 59328597 missense probably damaging 0.99
IGL03328:Bbs4 APN 9 59344118 missense probably damaging 1.00
R0964:Bbs4 UTSW 9 59322976 makesense probably null
R1944:Bbs4 UTSW 9 59330415 splice site probably null
R2986:Bbs4 UTSW 9 59341195 missense probably damaging 1.00
R4118:Bbs4 UTSW 9 59330425 missense possibly damaging 0.90
R4701:Bbs4 UTSW 9 59323519 missense probably benign
R6930:Bbs4 UTSW 9 59323481 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCTGCTGATGCTTACGAACTCC -3'
(R):5'- CCGGTTCCAAGTTATCCTTGGTCAC -3'

Sequencing Primer
(F):5'- tgcatttcaggtcagccag -3'
(R):5'- CAAGTTATCCTTGGTCACACAGTG -3'
Posted On2014-02-18