Incidental Mutation 'R1298:Sobp'
ID158219
Institutional Source Beutler Lab
Gene Symbol Sobp
Ensembl Gene ENSMUSG00000038248
Gene Namesine oculis binding protein
Synonyms2900009C16Rik, jc, 5330439J01Rik, Jxc1
MMRRC Submission 039364-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.697) question?
Stock #R1298 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location43002500-43174530 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 43022335 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 418 (H418L)
Ref Sequence ENSEMBL: ENSMUSP00000040072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040275]
Predicted Effect probably damaging
Transcript: ENSMUST00000040275
AA Change: H418L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040072
Gene: ENSMUSG00000038248
AA Change: H418L

DomainStartEndE-ValueType
low complexity region 125 139 N/A INTRINSIC
internal_repeat_1 149 201 2.34e-5 PROSPERO
Pfam:SOBP 224 543 1.5e-88 PFAM
low complexity region 565 583 N/A INTRINSIC
low complexity region 590 603 N/A INTRINSIC
low complexity region 625 639 N/A INTRINSIC
low complexity region 695 714 N/A INTRINSIC
low complexity region 725 747 N/A INTRINSIC
Meta Mutation Damage Score 0.1157 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.1%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear zinc finger protein that is involved in development of the cochlea. Defects in this gene have also been linked to intellectual disability. [provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygous mutant mice exhibit open-field hyperactivity and circling behavior from weaning. Their hearing thresholds are elevated at all frequencies; the hearing impairment does not progress over time. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox5 A G 6: 116,427,264 W145R probably damaging Het
Aspm T A 1: 139,457,419 V267D probably benign Het
Bbs4 A T 9: 59,339,813 W135R probably damaging Het
Cavin4 T C 4: 48,672,593 V346A probably benign Het
Cdk18 A C 1: 132,122,451 probably benign Het
Cyp2j11 C T 4: 96,307,260 probably null Het
Dnah6 A T 6: 73,159,135 I1007K probably damaging Het
Dnmt1 T C 9: 20,941,456 E118G probably benign Het
Eef2 C CN 10: 81,178,768 probably null Het
Gm14496 T C 2: 181,996,092 F320L probably benign Het
Gm2046 T A 12: 87,980,083 D98E probably benign Het
Gsdmc3 A T 15: 63,860,281 L299M probably damaging Het
H6pd T C 4: 149,982,514 I472V probably benign Het
Hao2 G T 3: 98,883,669 T63K possibly damaging Het
Jag2 C T 12: 112,916,319 probably benign Het
Mapre3 A G 5: 30,864,867 Y211C probably damaging Het
Mycbp2 A G 14: 103,155,898 S2966P probably damaging Het
Nsd3 T A 8: 25,679,936 V696E possibly damaging Het
Obscn A G 11: 59,054,897 Y4163H possibly damaging Het
Olfr1120 G A 2: 87,358,070 A209T probably benign Het
Olfr747 A T 14: 50,680,880 Y251* probably null Het
Olfr788 G T 10: 129,473,064 C124F probably damaging Het
Pde2a A G 7: 101,507,202 E607G probably benign Het
Pinlyp T A 7: 24,544,966 D51V probably damaging Het
Rcbtb2 T A 14: 73,162,388 I87N probably damaging Het
Sfswap A G 5: 129,541,378 I459V probably benign Het
Slitrk6 T C 14: 110,751,865 N137D possibly damaging Het
Smg1 A T 7: 118,168,211 probably benign Het
Spock1 A C 13: 57,512,750 D180E probably benign Het
Upk3a G A 15: 85,020,551 V167I probably benign Het
Vmn1r180 T C 7: 23,953,147 V245A possibly damaging Het
Zbtb25 T C 12: 76,350,001 E149G probably benign Het
Zgrf1 T C 3: 127,583,889 C44R possibly damaging Het
Other mutations in Sobp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01016:Sobp APN 10 43022878 missense probably damaging 1.00
IGL02112:Sobp APN 10 43021877 missense probably benign 0.07
R0071:Sobp UTSW 10 43157997 missense probably damaging 1.00
R0071:Sobp UTSW 10 43157997 missense probably damaging 1.00
R0602:Sobp UTSW 10 43022389 missense probably damaging 1.00
R0792:Sobp UTSW 10 43022693 missense probably damaging 0.99
R0847:Sobp UTSW 10 43022419 missense probably damaging 1.00
R0948:Sobp UTSW 10 43022209 missense probably damaging 1.00
R1484:Sobp UTSW 10 43160831 missense probably damaging 1.00
R1486:Sobp UTSW 10 43022522 missense probably benign 0.42
R1543:Sobp UTSW 10 43021724 missense probably damaging 0.97
R1571:Sobp UTSW 10 43157946 missense possibly damaging 0.93
R1807:Sobp UTSW 10 43160826 missense possibly damaging 0.79
R2198:Sobp UTSW 10 43022524 missense possibly damaging 0.81
R2316:Sobp UTSW 10 43158038 missense possibly damaging 0.75
R4165:Sobp UTSW 10 43021648 missense probably damaging 1.00
R4235:Sobp UTSW 10 43022900 missense probably damaging 1.00
R4378:Sobp UTSW 10 43021304 missense probably damaging 0.97
R4587:Sobp UTSW 10 43158024 missense probably damaging 1.00
R5108:Sobp UTSW 10 43160819 missense probably damaging 1.00
R6165:Sobp UTSW 10 43022603 missense probably damaging 1.00
R7069:Sobp UTSW 10 43021440 missense probably benign 0.37
R7346:Sobp UTSW 10 43022835 missense probably damaging 1.00
R7419:Sobp UTSW 10 43021808 missense probably benign 0.00
R7423:Sobp UTSW 10 43022568 nonsense probably null
R7475:Sobp UTSW 10 43021834 missense probably damaging 0.98
R7994:Sobp UTSW 10 43021167 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCATCATCTGGGGAACCGGCATC -3'
(R):5'- ACACTGCCAACTGCTCTGTCAC -3'

Sequencing Primer
(F):5'- TGGCATCATGCTAACCGGAG -3'
(R):5'- AGCGAGACTCCGAGCATC -3'
Posted On2014-02-18