Incidental Mutation 'R1298:Eef2'
ID158220
Institutional Source Beutler Lab
Gene Symbol Eef2
Ensembl Gene ENSMUSG00000034994
Gene Nameeukaryotic translation elongation factor 2
SynonymsEf-2
MMRRC Submission 039364-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.971) question?
Stock #R1298 (G1)
Quality Score171
Status Not validated
Chromosome10
Chromosomal Location81176631-81182498 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) C to CN at 81178768 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000046101 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047665] [ENSMUST00000047864] [ENSMUST00000056086] [ENSMUST00000178422] [ENSMUST00000218157] [ENSMUST00000219133]
Predicted Effect probably benign
Transcript: ENSMUST00000047665
SMART Domains Protein: ENSMUSP00000035962
Gene: ENSMUSG00000034974

DomainStartEndE-ValueType
S_TKc 13 275 1.93e-98 SMART
low complexity region 288 299 N/A INTRINSIC
low complexity region 331 347 N/A INTRINSIC
low complexity region 349 411 N/A INTRINSIC
coiled coil region 419 444 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000047864
SMART Domains Protein: ENSMUSP00000046101
Gene: ENSMUSG00000034994

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 360 2e-65 PFAM
Pfam:MMR_HSR1 21 159 6.3e-6 PFAM
Pfam:GTP_EFTU_D2 409 486 2.3e-14 PFAM
Pfam:EFG_II 501 568 1.9e-14 PFAM
EFG_IV 621 737 5.56e-27 SMART
EFG_C 739 828 4.06e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000056086
SMART Domains Protein: ENSMUSP00000049685
Gene: ENSMUSG00000053603

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082507
Predicted Effect probably benign
Transcript: ENSMUST00000178422
SMART Domains Protein: ENSMUSP00000137333
Gene: ENSMUSG00000034974

DomainStartEndE-ValueType
S_TKc 13 275 1.93e-98 SMART
low complexity region 288 299 N/A INTRINSIC
low complexity region 331 347 N/A INTRINSIC
low complexity region 349 411 N/A INTRINSIC
coiled coil region 419 444 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217936
Predicted Effect probably benign
Transcript: ENSMUST00000218157
Predicted Effect probably benign
Transcript: ENSMUST00000219133
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219329
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219497
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219943
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220076
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.1%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GTP-binding translation elongation factor family. This protein is an essential factor for protein synthesis. It promotes the GTP-dependent translocation of the nascent protein chain from the A-site to the P-site of the ribosome. This protein is completely inactivated by EF-2 kinase phosporylation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a mutation removing the diphthamide modification display partial neonatal lethality, fetal growth retardation and abnormal cell physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox5 A G 6: 116,427,264 W145R probably damaging Het
Aspm T A 1: 139,457,419 V267D probably benign Het
Bbs4 A T 9: 59,339,813 W135R probably damaging Het
Cavin4 T C 4: 48,672,593 V346A probably benign Het
Cdk18 A C 1: 132,122,451 probably benign Het
Cyp2j11 C T 4: 96,307,260 probably null Het
Dnah6 A T 6: 73,159,135 I1007K probably damaging Het
Dnmt1 T C 9: 20,941,456 E118G probably benign Het
Gm14496 T C 2: 181,996,092 F320L probably benign Het
Gm2046 T A 12: 87,980,083 D98E probably benign Het
Gsdmc3 A T 15: 63,860,281 L299M probably damaging Het
H6pd T C 4: 149,982,514 I472V probably benign Het
Hao2 G T 3: 98,883,669 T63K possibly damaging Het
Jag2 C T 12: 112,916,319 probably benign Het
Mapre3 A G 5: 30,864,867 Y211C probably damaging Het
Mycbp2 A G 14: 103,155,898 S2966P probably damaging Het
Nsd3 T A 8: 25,679,936 V696E possibly damaging Het
Obscn A G 11: 59,054,897 Y4163H possibly damaging Het
Olfr1120 G A 2: 87,358,070 A209T probably benign Het
Olfr747 A T 14: 50,680,880 Y251* probably null Het
Olfr788 G T 10: 129,473,064 C124F probably damaging Het
Pde2a A G 7: 101,507,202 E607G probably benign Het
Pinlyp T A 7: 24,544,966 D51V probably damaging Het
Rcbtb2 T A 14: 73,162,388 I87N probably damaging Het
Sfswap A G 5: 129,541,378 I459V probably benign Het
Slitrk6 T C 14: 110,751,865 N137D possibly damaging Het
Smg1 A T 7: 118,168,211 probably benign Het
Sobp T A 10: 43,022,335 H418L probably damaging Het
Spock1 A C 13: 57,512,750 D180E probably benign Het
Upk3a G A 15: 85,020,551 V167I probably benign Het
Vmn1r180 T C 7: 23,953,147 V245A possibly damaging Het
Zbtb25 T C 12: 76,350,001 E149G probably benign Het
Zgrf1 T C 3: 127,583,889 C44R possibly damaging Het
Other mutations in Eef2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01303:Eef2 APN 10 81181943 missense possibly damaging 0.93
IGL01303:Eef2 APN 10 81181982 splice site probably null
IGL01376:Eef2 APN 10 81178049 unclassified probably benign
IGL01876:Eef2 APN 10 81180270 missense probably benign
IGL02000:Eef2 APN 10 81180011 missense probably benign 0.13
IGL02514:Eef2 APN 10 81179593 missense probably benign 0.11
IGL03087:Eef2 APN 10 81181247 missense probably benign 0.12
IGL03389:Eef2 APN 10 81179706 missense probably benign 0.40
fig UTSW 10 81180292 missense possibly damaging 0.50
R0052:Eef2 UTSW 10 81178768 frame shift probably null
R0178:Eef2 UTSW 10 81180292 missense possibly damaging 0.50
R0445:Eef2 UTSW 10 81178770 frame shift probably null
R0497:Eef2 UTSW 10 81181586 missense probably benign 0.00
R0539:Eef2 UTSW 10 81178768 frame shift probably null
R0745:Eef2 UTSW 10 81181996 missense probably benign 0.00
R0811:Eef2 UTSW 10 81178769 frame shift probably null
R0812:Eef2 UTSW 10 81178769 frame shift probably null
R0832:Eef2 UTSW 10 81178769 frame shift probably null
R1136:Eef2 UTSW 10 81178769 frame shift probably null
R1549:Eef2 UTSW 10 81178768 frame shift probably null
R1550:Eef2 UTSW 10 81180847 missense probably benign 0.04
R2869:Eef2 UTSW 10 81178767 frame shift probably null
R2870:Eef2 UTSW 10 81178767 frame shift probably null
R2871:Eef2 UTSW 10 81178767 frame shift probably null
R2872:Eef2 UTSW 10 81178767 frame shift probably null
R3408:Eef2 UTSW 10 81178767 frame shift probably null
R3414:Eef2 UTSW 10 81177858 missense probably damaging 0.98
R4291:Eef2 UTSW 10 81179580 missense probably benign 0.00
R4357:Eef2 UTSW 10 81178767 frame shift probably null
R4433:Eef2 UTSW 10 81178768 frame shift probably null
R4577:Eef2 UTSW 10 81178767 frame shift probably null
R5154:Eef2 UTSW 10 81178767 frame shift probably null
R5609:Eef2 UTSW 10 81178769 frame shift probably null
R6545:Eef2 UTSW 10 81181114 missense probably damaging 1.00
R6649:Eef2 UTSW 10 81178768 frame shift probably null
R6650:Eef2 UTSW 10 81178768 frame shift probably null
R7326:Eef2 UTSW 10 81181282 missense probably benign 0.26
R7472:Eef2 UTSW 10 81179550 missense probably benign 0.01
R7579:Eef2 UTSW 10 81178768 frame shift probably null
R8013:Eef2 UTSW 10 81178196 missense probably damaging 1.00
R8143:Eef2 UTSW 10 81181348 missense probably damaging 1.00
Z1088:Eef2 UTSW 10 81181889 missense probably damaging 1.00
Z1176:Eef2 UTSW 10 81181158 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGTATGTGCCAGTCCCCATGTCAG -3'
(R):5'- TCATGGTGGGTCAGAGATTCCCAG -3'

Sequencing Primer
(F):5'- TGGTACACTGGACACACTTG -3'
(R):5'- TCAGAGATTCCCAGGGAGC -3'
Posted On2014-02-18